Incidental Mutation 'R4976:Epha5'
ID382650
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission 042571-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4976 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84084824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 777 (V777E)
Ref Sequence ENSEMBL: ENSMUSP00000109033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect probably damaging
Transcript: ENSMUST00000053733
AA Change: V636E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245
AA Change: V636E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113398
AA Change: V688E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: V688E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113399
AA Change: V800E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: V800E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113401
AA Change: V613E

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245
AA Change: V613E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113403
AA Change: V800E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: V800E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113406
AA Change: V777E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: V777E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,184 probably null Het
4930486L24Rik A T 13: 60,853,573 Y113* probably null Het
Abcc2 C T 19: 43,800,635 T243M probably benign Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts2 A G 11: 50,737,366 I298V possibly damaging Het
Adamts6 T A 13: 104,297,490 S142R probably damaging Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Alg6 G A 4: 99,750,728 probably null Het
Aoc3 T A 11: 101,330,974 L12Q probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Atp2b2 T A 6: 113,759,161 I986F probably damaging Het
Axin1 A T 17: 26,194,070 Q779L probably benign Het
Axin1 G T 17: 26,194,071 Q779H probably benign Het
Btaf1 T C 19: 36,986,579 V850A probably benign Het
Camsap2 A G 1: 136,304,386 V157A probably damaging Het
Ccdc191 T C 16: 43,943,505 V443A probably benign Het
Cd1d1 T A 3: 86,998,651 M106L probably benign Het
Cenpe A G 3: 135,234,876 D632G probably damaging Het
Cnih2 T A 19: 5,093,929 probably null Het
Crnkl1 G T 2: 145,923,876 Q425K possibly damaging Het
Crnn T A 3: 93,148,683 S259T probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 G T 11: 69,027,326 G425C probably damaging Het
Dctn4 T A 18: 60,556,392 I445N probably benign Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dock10 A T 1: 80,567,994 probably null Het
Dst A T 1: 34,195,969 K3710* probably null Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Elp6 C T 9: 110,314,073 P118L probably damaging Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Ep400 A G 5: 110,698,812 F1480L unknown Het
Ep400 T C 5: 110,720,756 E934G unknown Het
Epb41 A C 4: 131,937,436 probably benign Het
Erp44 A T 4: 48,208,797 M221K probably benign Het
Esp36 T C 17: 38,417,286 T35A possibly damaging Het
Flvcr1 T C 1: 191,025,495 Q158R probably damaging Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Fzd10 T A 5: 128,602,114 Y299* probably null Het
Gabrg1 C A 5: 70,774,411 V330L possibly damaging Het
Gata4 A T 14: 63,203,689 N87K probably damaging Het
Gdpd3 A T 7: 126,767,282 N97I probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm38394 T C 1: 133,658,094 T502A probably benign Het
Golim4 T C 3: 75,878,643 probably null Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Hsd17b4 T C 18: 50,160,135 L247S probably damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Igkv17-121 A G 6: 68,037,084 K40R probably benign Het
Igsf3 T A 3: 101,439,361 probably null Het
Ints1 C A 5: 139,752,811 G110C probably damaging Het
Klhdc8b A T 9: 108,451,187 V22E probably damaging Het
Kmt2d G A 15: 98,847,194 probably benign Het
Kpna2 C T 11: 106,991,469 G204S probably damaging Het
Ktn1 G A 14: 47,670,299 probably null Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lmx1a G T 1: 167,791,554 A161S possibly damaging Het
Lrig1 T C 6: 94,625,062 Y270C probably damaging Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Ltbp1 T C 17: 75,321,095 probably null Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Meltf T C 16: 31,894,714 S592P probably benign Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrpl39 A G 16: 84,734,405 probably null Het
Myocd T C 11: 65,222,050 T79A probably benign Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Ncoa3 T A 2: 166,047,900 D68E probably damaging Het
Nt5m T A 11: 59,874,555 Y136* probably null Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1564 C T 17: 33,215,754 A200T probably benign Het
Olfr490 A C 7: 108,286,611 C172G probably damaging Het
Olfr631 A T 7: 103,929,737 I305F probably benign Het
Olfr836 G A 9: 19,121,501 C179Y probably damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcyox1 T A 6: 86,388,726 K502M probably damaging Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Ppp2r2a A T 14: 67,016,637 S361T possibly damaging Het
Prim1 A T 10: 128,015,262 D5V probably damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Retsat T A 6: 72,601,626 M107K probably damaging Het
Rhbdl1 C T 17: 25,835,028 W289* probably null Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rprd2 T A 3: 95,766,349 T497S probably damaging Het
Rps6kc1 T C 1: 190,798,727 T936A probably damaging Het
Scgb1b10 A G 7: 32,101,184 Q66R possibly damaging Het
Scrib C T 15: 76,051,753 probably null Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Shox2 T C 3: 66,973,675 probably benign Het
Skp1a C A 11: 52,243,631 T63N probably benign Het
Slc10a6 C T 5: 103,606,604 V354M probably benign Het
Slc35f3 T C 8: 126,389,281 probably null Het
Slc8b1 T A 5: 120,525,675 L320* probably null Het
Snap29 T A 16: 17,419,268 L81Q probably damaging Het
Sorl1 A G 9: 41,983,003 I1837T probably benign Het
Tacr3 A G 3: 134,932,272 T397A probably benign Het
Tcte1 T C 17: 45,534,928 F153L probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tmprss4 A G 9: 45,173,408 S433P possibly damaging Het
Tpcn1 T C 5: 120,560,322 H45R probably benign Het
Uhrf1bp1 T C 17: 27,884,026 S345P probably damaging Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
BB001:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 splice site probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84233654 missense probably benign 0.19
R8043:Epha5 UTSW 5 84233654 missense probably benign 0.19
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Z1176:Epha5 UTSW 5 84071120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGCCTTATTGGAGGAATGCC -3'
(R):5'- CCTTGGGTAGAAATCACATTTGCATC -3'

Sequencing Primer
(F):5'- AGGAATGCCTTTTTGCTACTTC -3'
(R):5'- ATCACATTTGCATCTTGAAATGTG -3'
Posted On2016-04-27