Incidental Mutation 'R4976:Ncan'
ID 382672
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission 042571-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4976 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70567675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 146 (E146K)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002412
AA Change: E146K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: E146K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Meta Mutation Damage Score 0.1585 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 61,001,387 (GRCm39) Y113* probably null Het
Abcc2 C T 19: 43,789,074 (GRCm39) T243M probably benign Het
Actr6 A T 10: 89,561,717 (GRCm39) L143Q probably damaging Het
Adamts18 A G 8: 114,425,642 (GRCm39) Y1207H probably benign Het
Adamts2 A G 11: 50,628,193 (GRCm39) I298V possibly damaging Het
Adamts6 T A 13: 104,433,998 (GRCm39) S142R probably damaging Het
Adat2 A T 10: 13,432,650 (GRCm39) N51Y probably damaging Het
Alg6 G A 4: 99,638,965 (GRCm39) probably null Het
Aoc3 T A 11: 101,221,800 (GRCm39) L12Q probably damaging Het
Aox3 G A 1: 58,227,683 (GRCm39) probably null Het
Atp2b2 T A 6: 113,736,122 (GRCm39) I986F probably damaging Het
Axin1 G T 17: 26,413,045 (GRCm39) Q779H probably benign Het
Axin1 A T 17: 26,413,044 (GRCm39) Q779L probably benign Het
Bltp3a T C 17: 28,103,000 (GRCm39) S345P probably damaging Het
Btaf1 T C 19: 36,963,979 (GRCm39) V850A probably benign Het
Camsap2 A G 1: 136,232,124 (GRCm39) V157A probably damaging Het
Ccdc191 T C 16: 43,763,868 (GRCm39) V443A probably benign Het
Cd1d1 T A 3: 86,905,958 (GRCm39) M106L probably benign Het
Cenpe A G 3: 134,940,637 (GRCm39) D632G probably damaging Het
Cnih2 T A 19: 5,143,957 (GRCm39) probably null Het
Crnkl1 G T 2: 145,765,796 (GRCm39) Q425K possibly damaging Het
Crnn T A 3: 93,055,990 (GRCm39) S259T probably benign Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctc1 G T 11: 68,918,152 (GRCm39) G425C probably damaging Het
Dctn4 T A 18: 60,689,464 (GRCm39) I445N probably benign Het
Dnah7a A T 1: 53,737,851 (GRCm39) D27E probably benign Het
Dock10 A T 1: 80,545,711 (GRCm39) probably null Het
Dst A T 1: 34,235,050 (GRCm39) K3710* probably null Het
Ecel1 T A 1: 87,078,861 (GRCm39) Y526F probably benign Het
Elp6 C T 9: 110,143,141 (GRCm39) P118L probably damaging Het
Enpp2 T A 15: 54,733,701 (GRCm39) R420* probably null Het
Ep400 A G 5: 110,846,678 (GRCm39) F1480L unknown Het
Ep400 T C 5: 110,868,622 (GRCm39) E934G unknown Het
Epb41 A C 4: 131,664,747 (GRCm39) probably benign Het
Epha5 A T 5: 84,232,683 (GRCm39) V777E probably damaging Het
Erp44 A T 4: 48,208,797 (GRCm39) M221K probably benign Het
Esp36 T C 17: 38,728,177 (GRCm39) T35A possibly damaging Het
Flvcr1 T C 1: 190,757,692 (GRCm39) Q158R probably damaging Het
Fsip2 A T 2: 82,818,535 (GRCm39) D4756V probably damaging Het
Fzd10 T A 5: 128,679,178 (GRCm39) Y299* probably null Het
Gabrg1 C A 5: 70,931,754 (GRCm39) V330L possibly damaging Het
Gata4 A T 14: 63,441,138 (GRCm39) N87K probably damaging Het
Gdpd3 A T 7: 126,366,454 (GRCm39) N97I probably damaging Het
Gm28042 G A 2: 119,865,124 (GRCm39) A250T probably damaging Het
Golim4 T C 3: 75,785,950 (GRCm39) probably null Het
Gpr183 G T 14: 122,192,275 (GRCm39) T82N possibly damaging Het
Hsd17b4 T C 18: 50,293,202 (GRCm39) L247S probably damaging Het
Hsdl1 T A 8: 120,292,606 (GRCm39) Y203F possibly damaging Het
Igkv17-121 A G 6: 68,014,068 (GRCm39) K40R probably benign Het
Igsf3 T A 3: 101,346,677 (GRCm39) probably null Het
Ints1 C A 5: 139,738,566 (GRCm39) G110C probably damaging Het
Klhdc8b A T 9: 108,328,386 (GRCm39) V22E probably damaging Het
Kmt2d G A 15: 98,745,075 (GRCm39) probably benign Het
Kpna2 C T 11: 106,882,295 (GRCm39) G204S probably damaging Het
Ktn1 G A 14: 47,907,756 (GRCm39) probably null Het
Ldah G A 12: 8,277,237 (GRCm39) A58T probably benign Het
Lmx1a G T 1: 167,619,123 (GRCm39) A161S possibly damaging Het
Lrig1 T C 6: 94,602,043 (GRCm39) Y270C probably damaging Het
Lrrc24 T C 15: 76,600,200 (GRCm39) Q313R probably benign Het
Ltbp1 T C 17: 75,628,090 (GRCm39) probably null Het
Luzp1 A G 4: 136,270,708 (GRCm39) D977G possibly damaging Het
Mbd4 T C 6: 115,827,685 (GRCm39) T43A possibly damaging Het
Meak7 A C 8: 120,494,882 (GRCm39) L292R probably damaging Het
Meltf T C 16: 31,713,532 (GRCm39) S592P probably benign Het
Mrgpra4 A G 7: 47,631,466 (GRCm39) L45P probably damaging Het
Mrpl39 A G 16: 84,531,293 (GRCm39) probably null Het
Myocd T C 11: 65,112,876 (GRCm39) T79A probably benign Het
Myt1l A G 12: 29,882,302 (GRCm39) E499G unknown Het
Ncoa3 T A 2: 165,889,820 (GRCm39) D68E probably damaging Het
Nt5m T A 11: 59,765,381 (GRCm39) Y136* probably null Het
Or10h5 C T 17: 33,434,728 (GRCm39) A200T probably benign Het
Or4c12 A T 2: 89,774,147 (GRCm39) I104N possibly damaging Het
Or51m1 A T 7: 103,578,944 (GRCm39) I305F probably benign Het
Or5p66 A C 7: 107,885,818 (GRCm39) C172G probably damaging Het
Or7g21 G A 9: 19,032,797 (GRCm39) C179Y probably damaging Het
Pak6 A T 2: 118,525,029 (GRCm39) I552F probably damaging Het
Pcyox1 T A 6: 86,365,708 (GRCm39) K502M probably damaging Het
Phyhipl A T 10: 70,404,904 (GRCm39) D56E probably damaging Het
Ppp2r2a A T 14: 67,254,086 (GRCm39) S361T possibly damaging Het
Prim1 A T 10: 127,851,131 (GRCm39) D5V probably damaging Het
Prl7a1 A T 13: 27,817,564 (GRCm39) H233Q possibly damaging Het
Prpf40a A G 2: 53,034,861 (GRCm39) F776L probably damaging Het
Psmb1 T C 17: 15,718,524 (GRCm39) M1V probably null Het
Reln T A 5: 22,176,868 (GRCm39) N1933Y probably benign Het
Retsat T A 6: 72,578,609 (GRCm39) M107K probably damaging Het
Rhbdl1 C T 17: 26,054,002 (GRCm39) W289* probably null Het
Rlf G A 4: 121,004,652 (GRCm39) H1443Y probably damaging Het
Rpgrip1l T C 8: 92,007,444 (GRCm39) E382G probably damaging Het
Rprd2 T A 3: 95,673,661 (GRCm39) T497S probably damaging Het
Rps6kc1 T C 1: 190,530,924 (GRCm39) T936A probably damaging Het
Scgb1b10 A G 7: 31,800,609 (GRCm39) Q66R possibly damaging Het
Scrib C T 15: 75,923,602 (GRCm39) probably null Het
Setbp1 T A 18: 79,129,927 (GRCm39) T102S probably damaging Het
Shox2 T C 3: 66,881,008 (GRCm39) probably benign Het
Skp1 C A 11: 52,134,458 (GRCm39) T63N probably benign Het
Slc10a6 C T 5: 103,754,470 (GRCm39) V354M probably benign Het
Slc35f3 T C 8: 127,116,020 (GRCm39) probably null Het
Slc8b1 T A 5: 120,663,740 (GRCm39) L320* probably null Het
Snap29 T A 16: 17,237,132 (GRCm39) L81Q probably damaging Het
Sorl1 A G 9: 41,894,299 (GRCm39) I1837T probably benign Het
Spmip4 T A 6: 50,566,164 (GRCm39) probably null Het
Tacr3 A G 3: 134,638,033 (GRCm39) T397A probably benign Het
Tcte1 T C 17: 45,845,854 (GRCm39) F153L probably damaging Het
Them7 A G 2: 105,209,153 (GRCm39) T158A probably benign Het
Tmprss4 A G 9: 45,084,706 (GRCm39) S433P possibly damaging Het
Tpcn1 T C 5: 120,698,387 (GRCm39) H45R probably benign Het
Vps13d A G 4: 144,832,468 (GRCm39) S2813P possibly damaging Het
Wdfy3 C T 5: 102,090,985 (GRCm39) D532N probably benign Het
Zbed6 T C 1: 133,585,832 (GRCm39) T502A probably benign Het
Zfp277 A G 12: 40,378,687 (GRCm39) V390A possibly damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATTCCTCTCCAATCCTAGGCA -3'
(R):5'- TTCAGACTGCATCAGGCCAG -3'

Sequencing Primer
(F):5'- CCAATCCTAGGCACCTTCC -3'
(R):5'- CAGCGACAGGATTTGCCAATCTTG -3'
Posted On 2016-04-27