Mutagenetix > Incidental Mutation

Incidental Mutation 'R4976:Adamts18'

382674

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18

Synonyms

E130314N14Rik

MMRRC Submission

042571-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R4976 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113697126-113848738 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113699010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1207 (Y1207H)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

AlphaFold

Q4VC17

Predicted Effect

probably benign
Transcript: ENSMUST00000093113
AA Change: Y1207H

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: Y1207H

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Meta Mutation Damage Score

0.5858

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	T	A	6: 50,589,184		probably null	Het
4930486L24Rik	A	T	13: 60,853,573	Y113*	probably null	Het
Abcc2	C	T	19: 43,800,635	T243M	probably benign	Het
Actr6	A	T	10: 89,725,855	L143Q	probably damaging	Het
Adamts2	A	G	11: 50,737,366	I298V	possibly damaging	Het
Adamts6	T	A	13: 104,297,490	S142R	probably damaging	Het
Adat2	A	T	10: 13,556,906	N51Y	probably damaging	Het
Alg6	G	A	4: 99,750,728		probably null	Het
Aoc3	T	A	11: 101,330,974	L12Q	probably damaging	Het
Aox3	G	A	1: 58,188,524		probably null	Het
Atp2b2	T	A	6: 113,759,161	I986F	probably damaging	Het
Axin1	A	T	17: 26,194,070	Q779L	probably benign	Het
Axin1	G	T	17: 26,194,071	Q779H	probably benign	Het
Btaf1	T	C	19: 36,986,579	V850A	probably benign	Het
Camsap2	A	G	1: 136,304,386	V157A	probably damaging	Het
Ccdc191	T	C	16: 43,943,505	V443A	probably benign	Het
Cd1d1	T	A	3: 86,998,651	M106L	probably benign	Het
Cenpe	A	G	3: 135,234,876	D632G	probably damaging	Het
Cnih2	T	A	19: 5,093,929		probably null	Het
Crnkl1	G	T	2: 145,923,876	Q425K	possibly damaging	Het
Crnn	T	A	3: 93,148,683	S259T	probably benign	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctc1	G	T	11: 69,027,326	G425C	probably damaging	Het
Dctn4	T	A	18: 60,556,392	I445N	probably benign	Het
Dnah7a	A	T	1: 53,698,692	D27E	probably benign	Het
Dock10	A	T	1: 80,567,994		probably null	Het
Dst	A	T	1: 34,195,969	K3710*	probably null	Het
Ecel1	T	A	1: 87,151,139	Y526F	probably benign	Het
Elp6	C	T	9: 110,314,073	P118L	probably damaging	Het
Enpp2	T	A	15: 54,870,305	R420*	probably null	Het
Ep400	A	G	5: 110,698,812	F1480L	unknown	Het
Ep400	T	C	5: 110,720,756	E934G	unknown	Het
Epb41	A	C	4: 131,937,436		probably benign	Het
Epha5	A	T	5: 84,084,824	V777E	probably damaging	Het
Erp44	A	T	4: 48,208,797	M221K	probably benign	Het
Esp36	T	C	17: 38,417,286	T35A	possibly damaging	Het
Flvcr1	T	C	1: 191,025,495	Q158R	probably damaging	Het
Fsip2	A	T	2: 82,988,191	D4756V	probably damaging	Het
Fzd10	T	A	5: 128,602,114	Y299*	probably null	Het
Gabrg1	C	A	5: 70,774,411	V330L	possibly damaging	Het
Gata4	A	T	14: 63,203,689	N87K	probably damaging	Het
Gdpd3	A	T	7: 126,767,282	N97I	probably damaging	Het
Gm28042	G	A	2: 120,034,643	A250T	probably damaging	Het
Gm38394	T	C	1: 133,658,094	T502A	probably benign	Het
Golim4	T	C	3: 75,878,643		probably null	Het
Gpr183	G	T	14: 121,954,863	T82N	possibly damaging	Het
Hsd17b4	T	C	18: 50,160,135	L247S	probably damaging	Het
Hsdl1	T	A	8: 119,565,867	Y203F	possibly damaging	Het
Igkv17-121	A	G	6: 68,037,084	K40R	probably benign	Het
Igsf3	T	A	3: 101,439,361		probably null	Het
Ints1	C	A	5: 139,752,811	G110C	probably damaging	Het
Klhdc8b	A	T	9: 108,451,187	V22E	probably damaging	Het
Kmt2d	G	A	15: 98,847,194		probably benign	Het
Kpna2	C	T	11: 106,991,469	G204S	probably damaging	Het
Ktn1	G	A	14: 47,670,299		probably null	Het
Ldah	G	A	12: 8,227,237	A58T	probably benign	Het
Lmx1a	G	T	1: 167,791,554	A161S	possibly damaging	Het
Lrig1	T	C	6: 94,625,062	Y270C	probably damaging	Het
Lrrc24	T	C	15: 76,716,000	Q313R	probably benign	Het
Ltbp1	T	C	17: 75,321,095		probably null	Het
Luzp1	A	G	4: 136,543,397	D977G	possibly damaging	Het
Mbd4	T	C	6: 115,850,724	T43A	possibly damaging	Het
Meltf	T	C	16: 31,894,714	S592P	probably benign	Het
Mrgpra4	A	G	7: 47,981,718	L45P	probably damaging	Het
Mrpl39	A	G	16: 84,734,405		probably null	Het
Myocd	T	C	11: 65,222,050	T79A	probably benign	Het
Myt1l	A	G	12: 29,832,303	E499G	unknown	Het
Ncan	C	T	8: 70,115,025	E146K	probably damaging	Het
Ncoa3	T	A	2: 166,047,900	D68E	probably damaging	Het
Nt5m	T	A	11: 59,874,555	Y136*	probably null	Het
Olfr1259	A	T	2: 89,943,803	I104N	possibly damaging	Het
Olfr1564	C	T	17: 33,215,754	A200T	probably benign	Het
Olfr490	A	C	7: 108,286,611	C172G	probably damaging	Het
Olfr631	A	T	7: 103,929,737	I305F	probably benign	Het
Olfr836	G	A	9: 19,121,501	C179Y	probably damaging	Het
Pak6	A	T	2: 118,694,548	I552F	probably damaging	Het
Pcyox1	T	A	6: 86,388,726	K502M	probably damaging	Het
Phyhipl	A	T	10: 70,569,074	D56E	probably damaging	Het
Ppp2r2a	A	T	14: 67,016,637	S361T	possibly damaging	Het
Prim1	A	T	10: 128,015,262	D5V	probably damaging	Het
Prl7a1	A	T	13: 27,633,581	H233Q	possibly damaging	Het
Prpf40a	A	G	2: 53,144,849	F776L	probably damaging	Het
Psmb1	T	C	17: 15,498,262	M1V	probably null	Het
Reln	T	A	5: 21,971,870	N1933Y	probably benign	Het
Retsat	T	A	6: 72,601,626	M107K	probably damaging	Het
Rhbdl1	C	T	17: 25,835,028	W289*	probably null	Het
Rlf	G	A	4: 121,147,455	H1443Y	probably damaging	Het
Rpgrip1l	T	C	8: 91,280,816	E382G	probably damaging	Het
Rprd2	T	A	3: 95,766,349	T497S	probably damaging	Het
Rps6kc1	T	C	1: 190,798,727	T936A	probably damaging	Het
Scgb1b10	A	G	7: 32,101,184	Q66R	possibly damaging	Het
Scrib	C	T	15: 76,051,753		probably null	Het
Setbp1	T	A	18: 79,086,712	T102S	probably damaging	Het
Shox2	T	C	3: 66,973,675		probably benign	Het
Skp1a	C	A	11: 52,243,631	T63N	probably benign	Het
Slc10a6	C	T	5: 103,606,604	V354M	probably benign	Het
Slc35f3	T	C	8: 126,389,281		probably null	Het
Slc8b1	T	A	5: 120,525,675	L320*	probably null	Het
Snap29	T	A	16: 17,419,268	L81Q	probably damaging	Het
Sorl1	A	G	9: 41,983,003	I1837T	probably benign	Het
Tacr3	A	G	3: 134,932,272	T397A	probably benign	Het
Tcte1	T	C	17: 45,534,928	F153L	probably damaging	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Tldc1	A	C	8: 119,768,143	L292R	probably damaging	Het
Tmprss4	A	G	9: 45,173,408	S433P	possibly damaging	Het
Tpcn1	T	C	5: 120,560,322	H45R	probably benign	Het
Uhrf1bp1	T	C	17: 27,884,026	S345P	probably damaging	Het
Vps13d	A	G	4: 145,105,898	S2813P	possibly damaging	Het
Wdfy3	C	T	5: 101,943,119	D532N	probably benign	Het
Zfp277	A	G	12: 40,328,688	V390A	possibly damaging	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	113774943	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	113764299	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	113845109	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	113743096	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	113713194	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	113699072	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	113714344	splice site	probably benign
IGL03188:Adamts18	APN	8	113699024	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	113764297	nonsense	probably null
G1patch:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R0119:Adamts18	UTSW	8	113774953	missense	possibly damaging	0.94
R0378:Adamts18	UTSW	8	113743117	missense	probably damaging	1.00
R0410:Adamts18	UTSW	8	113714358	nonsense	probably null
R0480:Adamts18	UTSW	8	113738818	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	113738769	splice site	probably null
R0924:Adamts18	UTSW	8	113705396	splice site	probably null
R0930:Adamts18	UTSW	8	113705396	splice site	probably null
R1333:Adamts18	UTSW	8	113705173	splice site	probably benign
R1441:Adamts18	UTSW	8	113754562	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	113775333	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	113845003	missense	possibly damaging	0.58
R2371:Adamts18	UTSW	8	113705261	missense	probably benign	0.36
R3148:Adamts18	UTSW	8	113738858	missense	probably damaging	1.00
R3963:Adamts18	UTSW	8	113777811	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	113737580	nonsense	probably null
R4486:Adamts18	UTSW	8	113713193	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	113737613	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	113773168	nonsense	probably null
R4626:Adamts18	UTSW	8	113773168	nonsense	probably null
R4627:Adamts18	UTSW	8	113773168	nonsense	probably null
R4628:Adamts18	UTSW	8	113773168	nonsense	probably null
R4629:Adamts18	UTSW	8	113773168	nonsense	probably null
R4710:Adamts18	UTSW	8	113706926	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	113736725	nonsense	probably null
R4973:Adamts18	UTSW	8	113736725	nonsense	probably null
R5119:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5141:Adamts18	UTSW	8	113775270	missense	probably damaging	1.00
R5422:Adamts18	UTSW	8	113698974	missense	probably benign	0.06
R5587:Adamts18	UTSW	8	113775360	nonsense	probably null
R5868:Adamts18	UTSW	8	113777748	missense	possibly damaging	0.69
R5893:Adamts18	UTSW	8	113773077	missense	probably damaging	1.00
R5906:Adamts18	UTSW	8	113709619	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	113777748	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	113706974	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	113775279	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	113775290	missense	possibly damaging	0.69
R7276:Adamts18	UTSW	8	113775264	missense	probably damaging	0.99
R7292:Adamts18	UTSW	8	113709645	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	113777730	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	113713223	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	113736934	splice site	probably null
R7860:Adamts18	UTSW	8	113775276	missense	probably damaging	1.00
R7936:Adamts18	UTSW	8	113767128	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	113754595	missense	probably damaging	1.00
R8363:Adamts18	UTSW	8	113767163	missense	probably damaging	1.00
R8759:Adamts18	UTSW	8	113706992	missense	probably damaging	1.00
R8934:Adamts18	UTSW	8	113736878	missense	possibly damaging	0.90
R9405:Adamts18	UTSW	8	113703398	missense	probably damaging	1.00
R9422:Adamts18	UTSW	8	113775278	missense	probably damaging	1.00
R9450:Adamts18	UTSW	8	113764310	missense	probably benign	0.10
R9475:Adamts18	UTSW	8	113777938	missense	possibly damaging	0.93
Z1088:Adamts18	UTSW	8	113775440	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	113743168	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TACCATGTGTTTCCAGGGGTC -3'
(R):5'- CATATCATGGGCAGAACACATGG -3'

Sequencing Primer
(F):5'- CATGTGTTTCCAGGGGTCAACTAAG -3'
(R):5'- CACATGGAGGAACAAGGCAGTG -3'

Posted On

2016-04-27