Incidental Mutation 'R4976:Sorl1'
ID 382679
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms 2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 042571-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock # R4976 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 41964720-42124297 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41983003 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1837 (I1837T)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably benign
Transcript: ENSMUST00000060989
AA Change: I1837T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: I1837T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148800
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,184 probably null Het
4930486L24Rik A T 13: 60,853,573 Y113* probably null Het
Abcc2 C T 19: 43,800,635 T243M probably benign Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts2 A G 11: 50,737,366 I298V possibly damaging Het
Adamts6 T A 13: 104,297,490 S142R probably damaging Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Alg6 G A 4: 99,750,728 probably null Het
Aoc3 T A 11: 101,330,974 L12Q probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Atp2b2 T A 6: 113,759,161 I986F probably damaging Het
Axin1 A T 17: 26,194,070 Q779L probably benign Het
Axin1 G T 17: 26,194,071 Q779H probably benign Het
Btaf1 T C 19: 36,986,579 V850A probably benign Het
Camsap2 A G 1: 136,304,386 V157A probably damaging Het
Ccdc191 T C 16: 43,943,505 V443A probably benign Het
Cd1d1 T A 3: 86,998,651 M106L probably benign Het
Cenpe A G 3: 135,234,876 D632G probably damaging Het
Cnih2 T A 19: 5,093,929 probably null Het
Crnkl1 G T 2: 145,923,876 Q425K possibly damaging Het
Crnn T A 3: 93,148,683 S259T probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 G T 11: 69,027,326 G425C probably damaging Het
Dctn4 T A 18: 60,556,392 I445N probably benign Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dock10 A T 1: 80,567,994 probably null Het
Dst A T 1: 34,195,969 K3710* probably null Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Elp6 C T 9: 110,314,073 P118L probably damaging Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Ep400 A G 5: 110,698,812 F1480L unknown Het
Ep400 T C 5: 110,720,756 E934G unknown Het
Epb41 A C 4: 131,937,436 probably benign Het
Epha5 A T 5: 84,084,824 V777E probably damaging Het
Erp44 A T 4: 48,208,797 M221K probably benign Het
Esp36 T C 17: 38,417,286 T35A possibly damaging Het
Flvcr1 T C 1: 191,025,495 Q158R probably damaging Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Fzd10 T A 5: 128,602,114 Y299* probably null Het
Gabrg1 C A 5: 70,774,411 V330L possibly damaging Het
Gata4 A T 14: 63,203,689 N87K probably damaging Het
Gdpd3 A T 7: 126,767,282 N97I probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm38394 T C 1: 133,658,094 T502A probably benign Het
Golim4 T C 3: 75,878,643 probably null Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Hsd17b4 T C 18: 50,160,135 L247S probably damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Igkv17-121 A G 6: 68,037,084 K40R probably benign Het
Igsf3 T A 3: 101,439,361 probably null Het
Ints1 C A 5: 139,752,811 G110C probably damaging Het
Klhdc8b A T 9: 108,451,187 V22E probably damaging Het
Kmt2d G A 15: 98,847,194 probably benign Het
Kpna2 C T 11: 106,991,469 G204S probably damaging Het
Ktn1 G A 14: 47,670,299 probably null Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lmx1a G T 1: 167,791,554 A161S possibly damaging Het
Lrig1 T C 6: 94,625,062 Y270C probably damaging Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Ltbp1 T C 17: 75,321,095 probably null Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Meltf T C 16: 31,894,714 S592P probably benign Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrpl39 A G 16: 84,734,405 probably null Het
Myocd T C 11: 65,222,050 T79A probably benign Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Ncoa3 T A 2: 166,047,900 D68E probably damaging Het
Nt5m T A 11: 59,874,555 Y136* probably null Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1564 C T 17: 33,215,754 A200T probably benign Het
Olfr490 A C 7: 108,286,611 C172G probably damaging Het
Olfr631 A T 7: 103,929,737 I305F probably benign Het
Olfr836 G A 9: 19,121,501 C179Y probably damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcyox1 T A 6: 86,388,726 K502M probably damaging Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Ppp2r2a A T 14: 67,016,637 S361T possibly damaging Het
Prim1 A T 10: 128,015,262 D5V probably damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Retsat T A 6: 72,601,626 M107K probably damaging Het
Rhbdl1 C T 17: 25,835,028 W289* probably null Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rprd2 T A 3: 95,766,349 T497S probably damaging Het
Rps6kc1 T C 1: 190,798,727 T936A probably damaging Het
Scgb1b10 A G 7: 32,101,184 Q66R possibly damaging Het
Scrib C T 15: 76,051,753 probably null Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Shox2 T C 3: 66,973,675 probably benign Het
Skp1a C A 11: 52,243,631 T63N probably benign Het
Slc10a6 C T 5: 103,606,604 V354M probably benign Het
Slc35f3 T C 8: 126,389,281 probably null Het
Slc8b1 T A 5: 120,525,675 L320* probably null Het
Snap29 T A 16: 17,419,268 L81Q probably damaging Het
Tacr3 A G 3: 134,932,272 T397A probably benign Het
Tcte1 T C 17: 45,534,928 F153L probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tmprss4 A G 9: 45,173,408 S433P possibly damaging Het
Tpcn1 T C 5: 120,560,322 H45R probably benign Het
Uhrf1bp1 T C 17: 27,884,026 S345P probably damaging Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
R7763:Sorl1 UTSW 9 42043909 missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42089961 missense probably benign 0.17
R7956:Sorl1 UTSW 9 41989359 missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41991401 missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R8151:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R8219:Sorl1 UTSW 9 42041561 splice site probably null
R8261:Sorl1 UTSW 9 42014481 missense probably damaging 1.00
R8283:Sorl1 UTSW 9 42030998 missense probably damaging 1.00
R8308:Sorl1 UTSW 9 42018160 missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8448:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8524:Sorl1 UTSW 9 41974074 missense probably damaging 1.00
R8869:Sorl1 UTSW 9 42022426 missense probably benign 0.01
R8898:Sorl1 UTSW 9 42000271 missense probably damaging 1.00
R8972:Sorl1 UTSW 9 42046552 missense probably damaging 1.00
R9012:Sorl1 UTSW 9 42071195 missense probably damaging 1.00
R9094:Sorl1 UTSW 9 42063754 missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41974124 nonsense probably null
R9278:Sorl1 UTSW 9 42046561 missense probably benign 0.01
R9288:Sorl1 UTSW 9 42041631 missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41989443 missense probably damaging 1.00
R9330:Sorl1 UTSW 9 42067933 missense probably damaging 1.00
R9332:Sorl1 UTSW 9 42001518 missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42099203 missense possibly damaging 0.64
Z1176:Sorl1 UTSW 9 42123948 missense probably benign 0.03
Z1177:Sorl1 UTSW 9 41991638 missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42106541 missense probably benign 0.00
Z1177:Sorl1 UTSW 9 42123912 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGACTTGTGCCAGGTAAGG -3'
(R):5'- CCCAGTCTTTAGGACATACATTGC -3'

Sequencing Primer
(F):5'- CTTGTGCCAGGTAAGGAAAAG -3'
(R):5'- TTGAAAAATGGGGTGTGTGTAAACCC -3'
Posted On 2016-04-27