Incidental Mutation 'R0320:Tigd4'
ID38270
Institutional Source Beutler Lab
Gene Symbol Tigd4
Ensembl Gene ENSMUSG00000047819
Gene Nametigger transposable element derived 4
SynonymsTigd4, C130063O11Rik
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R0320 (G1)
Quality Score204
Status Validated
Chromosome3
Chromosomal Location84593574-84597032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84595174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 466 (V466E)
Ref Sequence ENSEMBL: ENSMUSP00000052320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062623] [ENSMUST00000154148]
Predicted Effect probably benign
Transcript: ENSMUST00000062623
AA Change: V466E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052320
Gene: ENSMUSG00000047819
AA Change: V466E

DomainStartEndE-ValueType
Pfam:CENP-B_N 15 67 9e-14 PFAM
CENPB 81 146 5.52e-16 SMART
Pfam:DDE_1 211 375 4.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,614 T465A probably benign Het
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Aldh3b1 T C 19: 3,918,999 probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Cit C A 5: 115,979,445 L1227M possibly damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dopey2 C A 16: 93,810,147 R2113S probably benign Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Nrip1 T C 16: 76,292,363 T769A probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Olfr689 A T 7: 105,314,654 I217F probably benign Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Parp4 T C 14: 56,588,496 probably null Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in Tigd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Tigd4 APN 3 84594745 missense probably damaging 1.00
R0080:Tigd4 UTSW 3 84594145 missense probably benign 0.19
R0347:Tigd4 UTSW 3 84593860 missense probably damaging 1.00
R1875:Tigd4 UTSW 3 84595087 missense probably benign 0.00
R1876:Tigd4 UTSW 3 84593935 nonsense probably null
R2142:Tigd4 UTSW 3 84594363 missense possibly damaging 0.95
R2258:Tigd4 UTSW 3 84594293 missense probably benign 0.00
R2519:Tigd4 UTSW 3 84593914 missense probably damaging 1.00
R2866:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R3974:Tigd4 UTSW 3 84595278 missense possibly damaging 0.82
R4094:Tigd4 UTSW 3 84594640 missense probably damaging 1.00
R4967:Tigd4 UTSW 3 84595153 missense probably benign 0.03
R5155:Tigd4 UTSW 3 84594663 missense possibly damaging 0.96
R5878:Tigd4 UTSW 3 84594442 missense probably benign 0.09
R6174:Tigd4 UTSW 3 84595267 missense probably benign 0.02
R6960:Tigd4 UTSW 3 84594116 missense probably damaging 1.00
R7414:Tigd4 UTSW 3 84593821 missense probably benign 0.37
R7445:Tigd4 UTSW 3 84595164 missense probably benign 0.01
R7696:Tigd4 UTSW 3 84594917
X0023:Tigd4 UTSW 3 84593857 missense probably damaging 1.00
X0064:Tigd4 UTSW 3 84594478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCTGCTGTTGCTCTTGACC -3'
(R):5'- CCCGAGGAAAAGTTACTGCTCTGC -3'

Sequencing Primer
(F):5'- TGACTGCCCATGCAGTG -3'
(R):5'- GCAGCCGAACAATACGTGAC -3'
Posted On2013-05-23