Incidental Mutation 'R4976:Meltf'
ID 382708
Institutional Source Beutler Lab
Gene Symbol Meltf
Ensembl Gene ENSMUSG00000022780
Gene Name melanotransferrin
Synonyms MTf, melanotransferrin, Mfi2, CD228
MMRRC Submission 042571-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4976 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 31697628-31717838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31713532 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 592 (S592P)
Ref Sequence ENSEMBL: ENSMUSP00000023464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023464]
AlphaFold Q9R0R1
Predicted Effect probably benign
Transcript: ENSMUST00000023464
AA Change: S592P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780
AA Change: S592P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 23 364 2.62e-183 SMART
TR_FER 366 719 4.23e-178 SMART
low complexity region 721 734 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, exhibit no physical defects, and develop normally with no detectable alterations in iron metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 61,001,387 (GRCm39) Y113* probably null Het
Abcc2 C T 19: 43,789,074 (GRCm39) T243M probably benign Het
Actr6 A T 10: 89,561,717 (GRCm39) L143Q probably damaging Het
Adamts18 A G 8: 114,425,642 (GRCm39) Y1207H probably benign Het
Adamts2 A G 11: 50,628,193 (GRCm39) I298V possibly damaging Het
Adamts6 T A 13: 104,433,998 (GRCm39) S142R probably damaging Het
Adat2 A T 10: 13,432,650 (GRCm39) N51Y probably damaging Het
Alg6 G A 4: 99,638,965 (GRCm39) probably null Het
Aoc3 T A 11: 101,221,800 (GRCm39) L12Q probably damaging Het
Aox3 G A 1: 58,227,683 (GRCm39) probably null Het
Atp2b2 T A 6: 113,736,122 (GRCm39) I986F probably damaging Het
Axin1 G T 17: 26,413,045 (GRCm39) Q779H probably benign Het
Axin1 A T 17: 26,413,044 (GRCm39) Q779L probably benign Het
Bltp3a T C 17: 28,103,000 (GRCm39) S345P probably damaging Het
Btaf1 T C 19: 36,963,979 (GRCm39) V850A probably benign Het
Camsap2 A G 1: 136,232,124 (GRCm39) V157A probably damaging Het
Ccdc191 T C 16: 43,763,868 (GRCm39) V443A probably benign Het
Cd1d1 T A 3: 86,905,958 (GRCm39) M106L probably benign Het
Cenpe A G 3: 134,940,637 (GRCm39) D632G probably damaging Het
Cnih2 T A 19: 5,143,957 (GRCm39) probably null Het
Crnkl1 G T 2: 145,765,796 (GRCm39) Q425K possibly damaging Het
Crnn T A 3: 93,055,990 (GRCm39) S259T probably benign Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctc1 G T 11: 68,918,152 (GRCm39) G425C probably damaging Het
Dctn4 T A 18: 60,689,464 (GRCm39) I445N probably benign Het
Dnah7a A T 1: 53,737,851 (GRCm39) D27E probably benign Het
Dock10 A T 1: 80,545,711 (GRCm39) probably null Het
Dst A T 1: 34,235,050 (GRCm39) K3710* probably null Het
Ecel1 T A 1: 87,078,861 (GRCm39) Y526F probably benign Het
Elp6 C T 9: 110,143,141 (GRCm39) P118L probably damaging Het
Enpp2 T A 15: 54,733,701 (GRCm39) R420* probably null Het
Ep400 A G 5: 110,846,678 (GRCm39) F1480L unknown Het
Ep400 T C 5: 110,868,622 (GRCm39) E934G unknown Het
Epb41 A C 4: 131,664,747 (GRCm39) probably benign Het
Epha5 A T 5: 84,232,683 (GRCm39) V777E probably damaging Het
Erp44 A T 4: 48,208,797 (GRCm39) M221K probably benign Het
Esp36 T C 17: 38,728,177 (GRCm39) T35A possibly damaging Het
Flvcr1 T C 1: 190,757,692 (GRCm39) Q158R probably damaging Het
Fsip2 A T 2: 82,818,535 (GRCm39) D4756V probably damaging Het
Fzd10 T A 5: 128,679,178 (GRCm39) Y299* probably null Het
Gabrg1 C A 5: 70,931,754 (GRCm39) V330L possibly damaging Het
Gata4 A T 14: 63,441,138 (GRCm39) N87K probably damaging Het
Gdpd3 A T 7: 126,366,454 (GRCm39) N97I probably damaging Het
Gm28042 G A 2: 119,865,124 (GRCm39) A250T probably damaging Het
Golim4 T C 3: 75,785,950 (GRCm39) probably null Het
Gpr183 G T 14: 122,192,275 (GRCm39) T82N possibly damaging Het
Hsd17b4 T C 18: 50,293,202 (GRCm39) L247S probably damaging Het
Hsdl1 T A 8: 120,292,606 (GRCm39) Y203F possibly damaging Het
Igkv17-121 A G 6: 68,014,068 (GRCm39) K40R probably benign Het
Igsf3 T A 3: 101,346,677 (GRCm39) probably null Het
Ints1 C A 5: 139,738,566 (GRCm39) G110C probably damaging Het
Klhdc8b A T 9: 108,328,386 (GRCm39) V22E probably damaging Het
Kmt2d G A 15: 98,745,075 (GRCm39) probably benign Het
Kpna2 C T 11: 106,882,295 (GRCm39) G204S probably damaging Het
Ktn1 G A 14: 47,907,756 (GRCm39) probably null Het
Ldah G A 12: 8,277,237 (GRCm39) A58T probably benign Het
Lmx1a G T 1: 167,619,123 (GRCm39) A161S possibly damaging Het
Lrig1 T C 6: 94,602,043 (GRCm39) Y270C probably damaging Het
Lrrc24 T C 15: 76,600,200 (GRCm39) Q313R probably benign Het
Ltbp1 T C 17: 75,628,090 (GRCm39) probably null Het
Luzp1 A G 4: 136,270,708 (GRCm39) D977G possibly damaging Het
Mbd4 T C 6: 115,827,685 (GRCm39) T43A possibly damaging Het
Meak7 A C 8: 120,494,882 (GRCm39) L292R probably damaging Het
Mrgpra4 A G 7: 47,631,466 (GRCm39) L45P probably damaging Het
Mrpl39 A G 16: 84,531,293 (GRCm39) probably null Het
Myocd T C 11: 65,112,876 (GRCm39) T79A probably benign Het
Myt1l A G 12: 29,882,302 (GRCm39) E499G unknown Het
Ncan C T 8: 70,567,675 (GRCm39) E146K probably damaging Het
Ncoa3 T A 2: 165,889,820 (GRCm39) D68E probably damaging Het
Nt5m T A 11: 59,765,381 (GRCm39) Y136* probably null Het
Or10h5 C T 17: 33,434,728 (GRCm39) A200T probably benign Het
Or4c12 A T 2: 89,774,147 (GRCm39) I104N possibly damaging Het
Or51m1 A T 7: 103,578,944 (GRCm39) I305F probably benign Het
Or5p66 A C 7: 107,885,818 (GRCm39) C172G probably damaging Het
Or7g21 G A 9: 19,032,797 (GRCm39) C179Y probably damaging Het
Pak6 A T 2: 118,525,029 (GRCm39) I552F probably damaging Het
Pcyox1 T A 6: 86,365,708 (GRCm39) K502M probably damaging Het
Phyhipl A T 10: 70,404,904 (GRCm39) D56E probably damaging Het
Ppp2r2a A T 14: 67,254,086 (GRCm39) S361T possibly damaging Het
Prim1 A T 10: 127,851,131 (GRCm39) D5V probably damaging Het
Prl7a1 A T 13: 27,817,564 (GRCm39) H233Q possibly damaging Het
Prpf40a A G 2: 53,034,861 (GRCm39) F776L probably damaging Het
Psmb1 T C 17: 15,718,524 (GRCm39) M1V probably null Het
Reln T A 5: 22,176,868 (GRCm39) N1933Y probably benign Het
Retsat T A 6: 72,578,609 (GRCm39) M107K probably damaging Het
Rhbdl1 C T 17: 26,054,002 (GRCm39) W289* probably null Het
Rlf G A 4: 121,004,652 (GRCm39) H1443Y probably damaging Het
Rpgrip1l T C 8: 92,007,444 (GRCm39) E382G probably damaging Het
Rprd2 T A 3: 95,673,661 (GRCm39) T497S probably damaging Het
Rps6kc1 T C 1: 190,530,924 (GRCm39) T936A probably damaging Het
Scgb1b10 A G 7: 31,800,609 (GRCm39) Q66R possibly damaging Het
Scrib C T 15: 75,923,602 (GRCm39) probably null Het
Setbp1 T A 18: 79,129,927 (GRCm39) T102S probably damaging Het
Shox2 T C 3: 66,881,008 (GRCm39) probably benign Het
Skp1 C A 11: 52,134,458 (GRCm39) T63N probably benign Het
Slc10a6 C T 5: 103,754,470 (GRCm39) V354M probably benign Het
Slc35f3 T C 8: 127,116,020 (GRCm39) probably null Het
Slc8b1 T A 5: 120,663,740 (GRCm39) L320* probably null Het
Snap29 T A 16: 17,237,132 (GRCm39) L81Q probably damaging Het
Sorl1 A G 9: 41,894,299 (GRCm39) I1837T probably benign Het
Spmip4 T A 6: 50,566,164 (GRCm39) probably null Het
Tacr3 A G 3: 134,638,033 (GRCm39) T397A probably benign Het
Tcte1 T C 17: 45,845,854 (GRCm39) F153L probably damaging Het
Them7 A G 2: 105,209,153 (GRCm39) T158A probably benign Het
Tmprss4 A G 9: 45,084,706 (GRCm39) S433P possibly damaging Het
Tpcn1 T C 5: 120,698,387 (GRCm39) H45R probably benign Het
Vps13d A G 4: 144,832,468 (GRCm39) S2813P possibly damaging Het
Wdfy3 C T 5: 102,090,985 (GRCm39) D532N probably benign Het
Zbed6 T C 1: 133,585,832 (GRCm39) T502A probably benign Het
Zfp277 A G 12: 40,378,687 (GRCm39) V390A possibly damaging Het
Other mutations in Meltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Meltf APN 16 31,707,803 (GRCm39) missense probably damaging 1.00
IGL02942:Meltf APN 16 31,709,596 (GRCm39) nonsense probably null
IGL03340:Meltf APN 16 31,711,602 (GRCm39) missense probably damaging 1.00
R0734:Meltf UTSW 16 31,700,776 (GRCm39) missense probably damaging 0.99
R1023:Meltf UTSW 16 31,703,778 (GRCm39) missense probably damaging 1.00
R1751:Meltf UTSW 16 31,702,747 (GRCm39) missense probably damaging 1.00
R1767:Meltf UTSW 16 31,702,747 (GRCm39) missense probably damaging 1.00
R1851:Meltf UTSW 16 31,715,395 (GRCm39) missense probably benign 0.00
R1900:Meltf UTSW 16 31,700,787 (GRCm39) critical splice donor site probably null
R1993:Meltf UTSW 16 31,711,440 (GRCm39) nonsense probably null
R3423:Meltf UTSW 16 31,715,343 (GRCm39) nonsense probably null
R3425:Meltf UTSW 16 31,715,343 (GRCm39) nonsense probably null
R3804:Meltf UTSW 16 31,703,816 (GRCm39) missense probably benign 0.23
R4724:Meltf UTSW 16 31,711,323 (GRCm39) missense probably benign 0.03
R5007:Meltf UTSW 16 31,706,380 (GRCm39) missense possibly damaging 0.60
R5058:Meltf UTSW 16 31,706,421 (GRCm39) splice site probably null
R5534:Meltf UTSW 16 31,709,632 (GRCm39) critical splice donor site probably null
R5661:Meltf UTSW 16 31,700,744 (GRCm39) missense possibly damaging 0.65
R6028:Meltf UTSW 16 31,706,294 (GRCm39) missense possibly damaging 0.91
R6424:Meltf UTSW 16 31,699,080 (GRCm39) nonsense probably null
R6464:Meltf UTSW 16 31,709,594 (GRCm39) missense probably benign 0.19
R6479:Meltf UTSW 16 31,700,700 (GRCm39) missense probably damaging 1.00
R6525:Meltf UTSW 16 31,707,717 (GRCm39) nonsense probably null
R6629:Meltf UTSW 16 31,703,894 (GRCm39) missense probably damaging 1.00
R6964:Meltf UTSW 16 31,698,980 (GRCm39) missense probably benign 0.41
R7133:Meltf UTSW 16 31,711,617 (GRCm39) missense probably damaging 1.00
R7169:Meltf UTSW 16 31,698,980 (GRCm39) missense probably benign 0.41
R7198:Meltf UTSW 16 31,702,617 (GRCm39) missense possibly damaging 0.61
R7212:Meltf UTSW 16 31,709,632 (GRCm39) critical splice donor site probably null
R7246:Meltf UTSW 16 31,713,680 (GRCm39) missense probably damaging 1.00
R7407:Meltf UTSW 16 31,713,553 (GRCm39) missense probably damaging 1.00
R7424:Meltf UTSW 16 31,703,764 (GRCm39) missense probably damaging 1.00
R7475:Meltf UTSW 16 31,700,756 (GRCm39) missense probably benign 0.12
R7727:Meltf UTSW 16 31,702,612 (GRCm39) missense probably damaging 0.99
R7764:Meltf UTSW 16 31,699,085 (GRCm39) missense probably benign 0.01
R8220:Meltf UTSW 16 31,706,233 (GRCm39) missense probably benign 0.01
R8840:Meltf UTSW 16 31,716,020 (GRCm39) missense probably damaging 0.98
R8896:Meltf UTSW 16 31,709,522 (GRCm39) splice site probably benign
R9214:Meltf UTSW 16 31,697,763 (GRCm39) missense probably benign
R9563:Meltf UTSW 16 31,703,869 (GRCm39) missense probably damaging 1.00
R9638:Meltf UTSW 16 31,706,409 (GRCm39) missense possibly damaging 0.87
X0062:Meltf UTSW 16 31,699,018 (GRCm39) missense probably damaging 1.00
Z1177:Meltf UTSW 16 31,699,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTTATAAGCAGGGGC -3'
(R):5'- TCTCTAGCTTGGCTTACCTGGG -3'

Sequencing Primer
(F):5'- GGTAACCATGCCTGTCCTACTGAG -3'
(R):5'- GGCCTTGTCCAGAAGTCCATAC -3'
Posted On 2016-04-27