Incidental Mutation 'R4977:Fstl5'
ID382733
Institutional Source Beutler Lab
Gene Symbol Fstl5
Ensembl Gene ENSMUSG00000034098
Gene Namefollistatin-like 5
Synonyms9130207J01Rik
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location76074270-76710019 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 76410494 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 156 (Q156*)
Ref Sequence ENSEMBL: ENSMUSP00000125393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038364] [ENSMUST00000160261]
Predicted Effect probably null
Transcript: ENSMUST00000038364
AA Change: Q156*
SMART Domains Protein: ENSMUSP00000038506
Gene: ENSMUSG00000034098
AA Change: Q156*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159686
Predicted Effect probably null
Transcript: ENSMUST00000160261
AA Change: Q156*
SMART Domains Protein: ENSMUSP00000125393
Gene: ENSMUSG00000034098
AA Change: Q156*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Fstl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Fstl5 APN 3 76707828 missense probably benign 0.30
IGL01658:Fstl5 APN 3 76482255 missense possibly damaging 0.70
IGL01917:Fstl5 APN 3 76707846 missense probably damaging 1.00
IGL02073:Fstl5 APN 3 76659652 splice site probably benign
IGL02329:Fstl5 APN 3 76588995 missense probably damaging 1.00
IGL02651:Fstl5 APN 3 76593534 missense probably damaging 1.00
IGL02967:Fstl5 APN 3 76322191 missense probably damaging 1.00
IGL03004:Fstl5 APN 3 76648431 splice site probably benign
IGL03107:Fstl5 APN 3 76536311 missense probably damaging 1.00
IGL03113:Fstl5 APN 3 76429792 nonsense probably null
P0038:Fstl5 UTSW 3 76145062 missense probably damaging 1.00
PIT4131001:Fstl5 UTSW 3 76659699 missense probably damaging 0.99
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0078:Fstl5 UTSW 3 76659645 splice site probably benign
R0137:Fstl5 UTSW 3 76707479 missense probably damaging 1.00
R0183:Fstl5 UTSW 3 76322272 missense possibly damaging 0.86
R0330:Fstl5 UTSW 3 76707753 missense possibly damaging 0.80
R0427:Fstl5 UTSW 3 76707727 nonsense probably null
R0687:Fstl5 UTSW 3 76707812 missense possibly damaging 0.62
R1642:Fstl5 UTSW 3 76410622 missense possibly damaging 0.80
R1765:Fstl5 UTSW 3 76593476 missense possibly damaging 0.90
R1900:Fstl5 UTSW 3 76708160 missense probably damaging 1.00
R1996:Fstl5 UTSW 3 76707834 missense probably benign 0.19
R2157:Fstl5 UTSW 3 76708065 missense possibly damaging 0.46
R2228:Fstl5 UTSW 3 76482352 missense probably damaging 1.00
R2851:Fstl5 UTSW 3 76429738 splice site probably benign
R4021:Fstl5 UTSW 3 76628975 missense probably benign 0.00
R4086:Fstl5 UTSW 3 76648286 missense probably damaging 1.00
R4777:Fstl5 UTSW 3 76593500 missense probably damaging 1.00
R4829:Fstl5 UTSW 3 76322182 missense probably damaging 1.00
R4934:Fstl5 UTSW 3 76588965 missense probably damaging 1.00
R4955:Fstl5 UTSW 3 76223876 critical splice donor site probably null
R5166:Fstl5 UTSW 3 76628960 missense possibly damaging 0.86
R5232:Fstl5 UTSW 3 76144977 missense possibly damaging 0.89
R5313:Fstl5 UTSW 3 76593505 missense possibly damaging 0.90
R5584:Fstl5 UTSW 3 76322267 missense probably damaging 1.00
R5647:Fstl5 UTSW 3 76589092 missense probably damaging 1.00
R5842:Fstl5 UTSW 3 76322283 missense possibly damaging 0.94
R5978:Fstl5 UTSW 3 76145085 missense probably damaging 1.00
R6007:Fstl5 UTSW 3 76410592 missense probably damaging 1.00
R6064:Fstl5 UTSW 3 76322298 missense probably benign 0.13
R6327:Fstl5 UTSW 3 76707801 missense probably benign 0.31
R6386:Fstl5 UTSW 3 76322066 missense probably benign 0.13
R6523:Fstl5 UTSW 3 76536334 missense probably benign 0.00
R6852:Fstl5 UTSW 3 76707855 missense probably damaging 1.00
R6861:Fstl5 UTSW 3 76322216 missense probably damaging 1.00
R6866:Fstl5 UTSW 3 76322225 missense probably damaging 0.99
R7100:Fstl5 UTSW 3 76536293 missense probably benign 0.11
R7341:Fstl5 UTSW 3 76482397 splice site probably null
R7495:Fstl5 UTSW 3 76707792 missense possibly damaging 0.85
R7558:Fstl5 UTSW 3 76429785 missense possibly damaging 0.95
R7731:Fstl5 UTSW 3 76661762 missense probably damaging 1.00
R7787:Fstl5 UTSW 3 76429824 missense probably damaging 1.00
R7852:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7874:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7881:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R7935:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7957:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7964:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R8039:Fstl5 UTSW 3 76648418 missense possibly damaging 0.69
R8050:Fstl5 UTSW 3 76707503 missense probably benign 0.00
Z1176:Fstl5 UTSW 3 76707982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGCACCATGGGACTAGTTC -3'
(R):5'- ATGCCAGGTCGGTTTCAACC -3'

Sequencing Primer
(F):5'- CAGCACCATGGGACTAGTTCATTTAC -3'
(R):5'- AGGTCGGTTTCAACCCCATC -3'
Posted On2016-04-27