Incidental Mutation 'R4977:Zfp235'
ID 382758
Institutional Source Beutler Lab
Gene Symbol Zfp235
Ensembl Gene ENSMUSG00000047603
Gene Name zinc finger protein 235
Synonyms 0610030O19Rik
MMRRC Submission 042572-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4977 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 23833594-23842666 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 23841609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 676 (I676S)
Ref Sequence ENSEMBL: ENSMUSP00000050803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056549] [ENSMUST00000205680]
AlphaFold Q499D5
Predicted Effect possibly damaging
Transcript: ENSMUST00000056549
AA Change: I676S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050803
Gene: ENSMUSG00000047603
AA Change: I676S

DomainStartEndE-ValueType
KRAB 8 71 1.09e-15 SMART
ZnF_C2H2 283 305 1.79e-2 SMART
ZnF_C2H2 311 333 3.16e-3 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 6.99e-5 SMART
ZnF_C2H2 395 417 1.33e-1 SMART
ZnF_C2H2 423 445 3.16e-3 SMART
ZnF_C2H2 451 473 2.84e-5 SMART
ZnF_C2H2 479 501 6.32e-3 SMART
ZnF_C2H2 507 529 3.44e-4 SMART
ZnF_C2H2 535 557 2.12e-4 SMART
ZnF_C2H2 563 585 1.38e-3 SMART
ZnF_C2H2 591 613 2.27e-4 SMART
ZnF_C2H2 619 641 5.99e-4 SMART
ZnF_C2H2 647 669 5.9e-3 SMART
ZnF_C2H2 675 697 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205680
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein is a member of the Kruppel family of zinc finger proteins, and contains Kruppel-associated box (KRAB) A and B domains and 15 tandemly arrayed C2H2-type zinc fingers. It is an ortholog of the mouse Zfp93 protein. This gene is located in a cluster of zinc finger genes on 19q13.2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,026,899 (GRCm39) D910G probably benign Het
Amy1 C T 3: 113,363,026 (GRCm39) probably null Het
C1s2 A G 6: 124,612,598 (GRCm39) M19T probably damaging Het
Cadps2 A G 6: 23,599,478 (GRCm39) I276T probably damaging Het
Cdyl2 A G 8: 117,302,008 (GRCm39) C458R probably damaging Het
Cep112 T C 11: 108,325,062 (GRCm39) S35P probably damaging Het
Chd9 T C 8: 91,760,336 (GRCm39) L2027P possibly damaging Het
Clcn4 T A 7: 7,294,436 (GRCm39) I411F probably benign Het
Cyp3a57 T C 5: 145,286,236 (GRCm39) probably null Het
Dis3l A C 9: 64,214,483 (GRCm39) S919A probably benign Het
Dnah8 A G 17: 30,882,275 (GRCm39) T616A probably benign Het
Emx2 A G 19: 59,447,678 (GRCm39) T11A probably damaging Het
Fbxl18 A G 5: 142,871,840 (GRCm39) L465P probably damaging Het
Fbxw27 G A 9: 109,601,187 (GRCm39) T311I probably damaging Het
Fhip1b A T 7: 105,038,542 (GRCm39) D232E probably damaging Het
Fstl5 C T 3: 76,317,801 (GRCm39) Q156* probably null Het
Ggn G T 7: 28,871,621 (GRCm39) G334C probably damaging Het
Grik2 T C 10: 49,008,841 (GRCm39) N749D probably damaging Het
Helb A G 10: 119,946,786 (GRCm39) S176P probably benign Het
Hyal1 A G 9: 107,456,153 (GRCm39) D73G probably benign Het
Ifi205 C A 1: 173,842,574 (GRCm39) R374I probably benign Het
Ift172 A T 5: 31,429,460 (GRCm39) V567D possibly damaging Het
Ighv1-43 A T 12: 114,909,845 (GRCm39) S26T possibly damaging Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Jam3 A G 9: 27,009,669 (GRCm39) V309A probably damaging Het
Kcnh4 A T 11: 100,637,659 (GRCm39) L666Q probably damaging Het
Kcnk10 A G 12: 98,406,946 (GRCm39) V250A probably benign Het
Lama1 A G 17: 68,044,677 (GRCm39) Y192C probably damaging Het
Lamb2 G A 9: 108,364,846 (GRCm39) R1200H probably damaging Het
Lilra6 T G 7: 3,917,382 (GRCm39) R204S probably benign Het
Lrrn1 A G 6: 107,545,668 (GRCm39) I489V probably benign Het
Mdh2 T A 5: 135,812,263 (GRCm39) D57E probably damaging Het
Mfsd2a A G 4: 122,844,302 (GRCm39) S282P probably benign Het
Midn T A 10: 79,986,018 (GRCm39) I36N probably damaging Het
Mpped1 A T 15: 83,680,907 (GRCm39) probably benign Het
Myh10 A G 11: 68,689,197 (GRCm39) D1258G possibly damaging Het
Nup62 T C 7: 44,478,449 (GRCm39) S155P possibly damaging Het
Or2g7 A T 17: 38,378,638 (GRCm39) H192L possibly damaging Het
Or2t46 A G 11: 58,472,455 (GRCm39) T262A possibly damaging Het
Or52ab7 A T 7: 102,978,040 (GRCm39) M116L probably benign Het
Pex7 T C 10: 19,745,078 (GRCm39) T258A probably benign Het
Plg A G 17: 12,621,976 (GRCm39) D432G probably damaging Het
Plxnd1 A T 6: 115,971,337 (GRCm39) S144T probably damaging Het
Prkch T C 12: 73,749,667 (GRCm39) F420S possibly damaging Het
Psg26 A G 7: 18,209,235 (GRCm39) V391A probably benign Het
Psg29 G A 7: 16,942,556 (GRCm39) G186R probably damaging Het
Rev3l T A 10: 39,699,574 (GRCm39) I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,123 (GRCm39) probably benign Het
Runx1 T A 16: 92,441,235 (GRCm39) probably null Het
Sapcd1 A T 17: 35,245,427 (GRCm39) S119T possibly damaging Het
Sema5a T A 15: 32,679,332 (GRCm39) N870K probably damaging Het
Serpina3f G A 12: 104,183,314 (GRCm39) E59K probably benign Het
Slc8b1 A G 5: 120,662,352 (GRCm39) K299E possibly damaging Het
Slco1b2 G A 6: 141,603,283 (GRCm39) M221I probably benign Het
Smg5 C T 3: 88,263,032 (GRCm39) Q812* probably null Het
Smr3a T G 5: 88,155,962 (GRCm39) probably null Het
Syt9 G A 7: 107,103,479 (GRCm39) D426N probably damaging Het
Tcf25 T C 8: 124,115,374 (GRCm39) Y204H probably benign Het
Tmeff2 T A 1: 51,018,715 (GRCm39) C232* probably null Het
Tmem184a C A 5: 139,793,757 (GRCm39) G219V probably null Het
Tnc G T 4: 63,924,485 (GRCm39) T1071K possibly damaging Het
Tnn C A 1: 159,948,188 (GRCm39) G842W probably damaging Het
Tshz3 T A 7: 36,470,615 (GRCm39) I868N probably benign Het
Ulbp1 C T 10: 7,397,391 (GRCm39) R238H probably benign Het
Ushbp1 C T 8: 71,847,693 (GRCm39) probably null Het
Usp34 G C 11: 23,438,982 (GRCm39) D3515H probably damaging Het
Wdr91 T C 6: 34,887,726 (GRCm39) E10G probably damaging Het
Xdh A T 17: 74,205,965 (GRCm39) F1016L probably benign Het
Zfp619 G A 7: 39,186,811 (GRCm39) C947Y probably damaging Het
Zfp663 A G 2: 165,195,731 (GRCm39) S163P probably damaging Het
Zfp93 A G 7: 23,974,836 (GRCm39) I274V probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Zfp235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Zfp235 APN 7 23,836,505 (GRCm39) missense probably damaging 1.00
IGL02326:Zfp235 APN 7 23,834,727 (GRCm39) start codon destroyed probably null 0.98
R0107:Zfp235 UTSW 7 23,836,541 (GRCm39) missense probably damaging 1.00
R0271:Zfp235 UTSW 7 23,836,556 (GRCm39) missense possibly damaging 0.93
R0513:Zfp235 UTSW 7 23,841,644 (GRCm39) missense probably damaging 1.00
R1004:Zfp235 UTSW 7 23,840,169 (GRCm39) missense probably damaging 1.00
R1928:Zfp235 UTSW 7 23,840,563 (GRCm39) nonsense probably null
R1958:Zfp235 UTSW 7 23,839,771 (GRCm39) missense probably damaging 0.98
R2167:Zfp235 UTSW 7 23,840,387 (GRCm39) missense possibly damaging 0.80
R2511:Zfp235 UTSW 7 23,841,549 (GRCm39) missense probably damaging 1.00
R3013:Zfp235 UTSW 7 23,840,157 (GRCm39) missense probably damaging 0.98
R3806:Zfp235 UTSW 7 23,840,046 (GRCm39) missense probably benign 0.01
R4613:Zfp235 UTSW 7 23,841,101 (GRCm39) missense probably damaging 1.00
R4876:Zfp235 UTSW 7 23,840,384 (GRCm39) missense probably benign 0.01
R5085:Zfp235 UTSW 7 23,836,546 (GRCm39) missense probably damaging 0.96
R5664:Zfp235 UTSW 7 23,841,576 (GRCm39) missense probably damaging 1.00
R6440:Zfp235 UTSW 7 23,840,040 (GRCm39) missense probably damaging 0.96
R6650:Zfp235 UTSW 7 23,836,463 (GRCm39) splice site probably null
R7694:Zfp235 UTSW 7 23,841,525 (GRCm39) missense probably benign 0.37
R8031:Zfp235 UTSW 7 23,841,114 (GRCm39) missense probably benign 0.19
R8188:Zfp235 UTSW 7 23,841,296 (GRCm39) missense probably damaging 1.00
R8744:Zfp235 UTSW 7 23,839,924 (GRCm39) missense possibly damaging 0.56
R9115:Zfp235 UTSW 7 23,841,453 (GRCm39) missense probably damaging 1.00
R9244:Zfp235 UTSW 7 23,839,919 (GRCm39) missense probably benign 0.00
R9401:Zfp235 UTSW 7 23,841,551 (GRCm39) missense probably damaging 1.00
R9404:Zfp235 UTSW 7 23,839,862 (GRCm39) missense possibly damaging 0.92
R9523:Zfp235 UTSW 7 23,840,381 (GRCm39) missense probably benign 0.00
R9563:Zfp235 UTSW 7 23,841,669 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGCGATTCAGTCAGGCCTC -3'
(R):5'- ATAAAGAACTGATCTCCCAGCTG -3'

Sequencing Primer
(F):5'- GTTCATCAGATAATTCACACCGGGG -3'
(R):5'- TTCAAGGCTAGCCAGGTCTACAG -3'
Posted On 2016-04-27