Mutagenetix > Incidental Mutations

Incidental Mutation 'R4977:Dis3l'

382776

Institutional Source

Beutler Lab

Gene Symbol

Dis3l

Ensembl Gene

ENSMUSG00000032396

Gene Name

DIS3 like exosome 3'-5' exoribonuclease

Synonyms

MMRRC Submission

042572-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.332) question?

Stock #

R4977 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64306756-64341288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 64307201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 919 (S919A)

Ref Sequence

ENSEMBL: ENSMUSP00000113503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034964] [ENSMUST00000068367] [ENSMUST00000113890] [ENSMUST00000120760] [ENSMUST00000168844] [ENSMUST00000216594]

AlphaFold

Q8C0S1

Predicted Effect

probably benign
Transcript: ENSMUST00000034964

SMART Domains

Protein: ENSMUSP00000034964
Gene: ENSMUSG00000032397

Domain	Start	End	E-Value	Type
low complexity region	19	43	N/A	INTRINSIC
Pfam:Swi3	63	143	2.8e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000068367
AA Change: S919A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000063830
Gene: ENSMUSG00000032396
AA Change: S919A

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
RNB	382	734	4.82e-127	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113890
AA Change: S919A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000109522
Gene: ENSMUSG00000032396
AA Change: S919A

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
RNB	382	734	4.82e-127	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120760
AA Change: S919A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000113503
Gene: ENSMUSG00000032396
AA Change: S919A

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
RNB	382	734	4.82e-127	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168844
AA Change: S1002A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129772
Gene: ENSMUSG00000032396
AA Change: S1002A

Domain	Start	End	E-Value	Type
low complexity region	208	220	N/A	INTRINSIC
RNB	465	817	4.82e-127	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000216594

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic RNA exosome complex degrades unstable mRNAs and is involved in the regular turnover of other mRNAs. The protein encoded by this gene contains 3'-5' exoribonuclease activity and is a catalytic component of this complex. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,136,073	D910G	probably benign	Het
Amy1	C	T	3: 113,569,377		probably null	Het
C1s2	A	G	6: 124,635,639	M19T	probably damaging	Het
Cadps2	A	G	6: 23,599,479	I276T	probably damaging	Het
Cdyl2	A	G	8: 116,575,269	C458R	probably damaging	Het
Cep112	T	C	11: 108,434,236	S35P	probably damaging	Het
Chd9	T	C	8: 91,033,708	L2027P	possibly damaging	Het
Clcn4	T	A	7: 7,291,437	I411F	probably benign	Het
Cyp3a57	T	C	5: 145,349,426		probably null	Het
Dnah8	A	G	17: 30,663,301	T616A	probably benign	Het
Emx2	A	G	19: 59,459,246	T11A	probably damaging	Het
Fam160a2	A	T	7: 105,389,335	D232E	probably damaging	Het
Fbxl18	A	G	5: 142,886,085	L465P	probably damaging	Het
Fbxw27	G	A	9: 109,772,119	T311I	probably damaging	Het
Fstl5	C	T	3: 76,410,494	Q156*	probably null	Het
Ggn	G	T	7: 29,172,196	G334C	probably damaging	Het
Grik2	T	C	10: 49,132,745	N749D	probably damaging	Het
Helb	A	G	10: 120,110,881	S176P	probably benign	Het
Hyal1	A	G	9: 107,578,954	D73G	probably benign	Het
Ifi205	C	A	1: 174,015,008	R374I	probably benign	Het
Ift172	A	T	5: 31,272,116	V567D	possibly damaging	Het
Ighv1-43	A	T	12: 114,946,225	S26T	possibly damaging	Het
Il21	C	A	3: 37,232,504	S21I	probably damaging	Het
Jam3	A	G	9: 27,098,373	V309A	probably damaging	Het
Kcnh4	A	T	11: 100,746,833	L666Q	probably damaging	Het
Kcnk10	A	G	12: 98,440,687	V250A	probably benign	Het
Lama1	A	G	17: 67,737,682	Y192C	probably damaging	Het
Lamb2	G	A	9: 108,487,647	R1200H	probably damaging	Het
Lilra6	T	G	7: 3,914,383	R204S	probably benign	Het
Lrrn1	A	G	6: 107,568,707	I489V	probably benign	Het
Mdh2	T	A	5: 135,783,409	D57E	probably damaging	Het
Mfsd2a	A	G	4: 122,950,509	S282P	probably benign	Het
Midn	T	A	10: 80,150,184	I36N	probably damaging	Het
Mpped1	A	T	15: 83,796,706		probably benign	Het
Myh10	A	G	11: 68,798,371	D1258G	possibly damaging	Het
Nup62	T	C	7: 44,829,025	S155P	possibly damaging	Het
Olfr130	A	T	17: 38,067,747	H192L	possibly damaging	Het
Olfr325	A	G	11: 58,581,629	T262A	possibly damaging	Het
Olfr598	A	T	7: 103,328,833	M116L	probably benign	Het
Pex7	T	C	10: 19,869,332	T258A	probably benign	Het
Plg	A	G	17: 12,403,089	D432G	probably damaging	Het
Plxnd1	A	T	6: 115,994,376	S144T	probably damaging	Het
Prkch	T	C	12: 73,702,893	F420S	possibly damaging	Het
Psg26	A	G	7: 18,475,310	V391A	probably benign	Het
Psg29	G	A	7: 17,208,631	G186R	probably damaging	Het
Rev3l	T	A	10: 39,823,578	I1357K	possibly damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,916		probably benign	Het
Runx1	T	A	16: 92,644,347		probably null	Het
Sapcd1	A	T	17: 35,026,451	S119T	possibly damaging	Het
Sema5a	T	A	15: 32,679,186	N870K	probably damaging	Het
Serpina3f	G	A	12: 104,217,055	E59K	probably benign	Het
Slc8b1	A	G	5: 120,524,287	K299E	possibly damaging	Het
Slco1b2	G	A	6: 141,657,557	M221I	probably benign	Het
Smg5	C	T	3: 88,355,725	Q812*	probably null	Het
Smr3a	T	G	5: 88,008,103		probably null	Het
Syt9	G	A	7: 107,504,272	D426N	probably damaging	Het
Tcf25	T	C	8: 123,388,635	Y204H	probably benign	Het
Tmeff2	T	A	1: 50,979,556	C232*	probably null	Het
Tmem184a	C	A	5: 139,808,002	G219V	probably null	Het
Tnc	G	T	4: 64,006,248	T1071K	possibly damaging	Het
Tnn	C	A	1: 160,120,618	G842W	probably damaging	Het
Tshz3	T	A	7: 36,771,190	I868N	probably benign	Het
Ulbp1	C	T	10: 7,447,391	R238H	probably benign	Het
Ushbp1	C	T	8: 71,395,049		probably null	Het
Usp34	G	C	11: 23,488,982	D3515H	probably damaging	Het
Wdr91	T	C	6: 34,910,791	E10G	probably damaging	Het
Xdh	A	T	17: 73,898,970	F1016L	probably benign	Het
Zfp235	T	G	7: 24,142,184	I676S	possibly damaging	Het
Zfp619	G	A	7: 39,537,387	C947Y	probably damaging	Het
Zfp663	A	G	2: 165,353,811	S163P	probably damaging	Het
Zfp93	A	G	7: 24,275,411	I274V	probably benign	Het
Zswim4	C	T	8: 84,226,667		probably null	Het

Other mutations in Dis3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01736:Dis3l	APN	9	64319254	critical splice acceptor site	probably null
IGL01812:Dis3l	APN	9	64310237	missense	probably benign	0.00
IGL01838:Dis3l	APN	9	64308299	missense	probably benign	0.41
IGL02104:Dis3l	APN	9	64310329	missense	possibly damaging	0.61
IGL02478:Dis3l	APN	9	64314773	missense	probably benign	0.00
IGL02481:Dis3l	APN	9	64319080	splice site	probably null
IGL02483:Dis3l	APN	9	64319080	splice site	probably null
IGL02965:Dis3l	APN	9	64310484	missense	probably damaging	0.99
IGL03139:Dis3l	APN	9	64311950	missense	probably damaging	0.99
IGL03054:Dis3l	UTSW	9	64310440	critical splice donor site	probably null
R0066:Dis3l	UTSW	9	64319165	missense	probably benign	0.27
R0066:Dis3l	UTSW	9	64319165	missense	probably benign	0.27
R0724:Dis3l	UTSW	9	64307126	missense	possibly damaging	0.92
R0801:Dis3l	UTSW	9	64319154	missense	probably benign
R0925:Dis3l	UTSW	9	64341130	start codon destroyed	probably null	0.97
R1502:Dis3l	UTSW	9	64325787	missense	possibly damaging	0.68
R1541:Dis3l	UTSW	9	64307489	missense	probably benign	0.07
R1794:Dis3l	UTSW	9	64317776	missense	possibly damaging	0.67
R1929:Dis3l	UTSW	9	64330883	missense	probably damaging	0.96
R2007:Dis3l	UTSW	9	64308276	splice site	probably null
R2062:Dis3l	UTSW	9	64339573	missense	probably benign	0.02
R2152:Dis3l	UTSW	9	64307263	missense	probably benign	0.00
R2153:Dis3l	UTSW	9	64307263	missense	probably benign	0.00
R2154:Dis3l	UTSW	9	64307263	missense	probably benign	0.00
R2186:Dis3l	UTSW	9	64339612	nonsense	probably null
R2271:Dis3l	UTSW	9	64330883	missense	probably damaging	0.96
R2280:Dis3l	UTSW	9	64317794	missense	possibly damaging	0.70
R2287:Dis3l	UTSW	9	64307497	missense	probably benign	0.20
R3156:Dis3l	UTSW	9	64311750	missense	probably benign	0.25
R4664:Dis3l	UTSW	9	64330798	missense	unknown
R4775:Dis3l	UTSW	9	64330908	missense	probably benign	0.16
R4997:Dis3l	UTSW	9	64311942	missense	possibly damaging	0.76
R5097:Dis3l	UTSW	9	64319216	missense	probably damaging	1.00
R5579:Dis3l	UTSW	9	64330835	missense	probably benign	0.44
R5623:Dis3l	UTSW	9	64307603	missense	possibly damaging	0.70
R6310:Dis3l	UTSW	9	64322575	missense	probably benign	0.00
R6442:Dis3l	UTSW	9	64307555	missense	probably benign
R6505:Dis3l	UTSW	9	64307513	missense	probably benign	0.15
R6731:Dis3l	UTSW	9	64310438	splice site	probably null
R7008:Dis3l	UTSW	9	64310453	missense	possibly damaging	0.96
R7405:Dis3l	UTSW	9	64314704	missense	probably damaging	1.00
R7555:Dis3l	UTSW	9	64311937	nonsense	probably null
R7798:Dis3l	UTSW	9	64341017	missense	probably benign
R7890:Dis3l	UTSW	9	64322471	missense	probably benign	0.00
R8329:Dis3l	UTSW	9	64311830	missense	possibly damaging	0.50
R8715:Dis3l	UTSW	9	64307060	missense	probably benign
R8942:Dis3l	UTSW	9	64307593	missense	probably benign	0.22
R8973:Dis3l	UTSW	9	64339542	missense	probably damaging	0.96
R9189:Dis3l	UTSW	9	64310449	missense	probably benign	0.21
R9240:Dis3l	UTSW	9	64310165	critical splice donor site	probably null
R9354:Dis3l	UTSW	9	64314640	missense	probably benign	0.01
R9394:Dis3l	UTSW	9	64317735	missense	probably benign	0.24
X0020:Dis3l	UTSW	9	64325734	missense	probably damaging	1.00
X0065:Dis3l	UTSW	9	64307054	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GACATGGAAGTATTTCACATTGCAC -3'
(R):5'- CTATTTGACCATGTGACGGTAAG -3'

Sequencing Primer
(F):5'- TTCACATTGCACAACTGTCAGAG -3'
(R):5'- GACGGTAAGTCTCTGCATTCAATG -3'

Posted On

2016-04-27