Incidental Mutation 'R4977:Dis3l'
ID 382776
Institutional Source Beutler Lab
Gene Symbol Dis3l
Ensembl Gene ENSMUSG00000032396
Gene Name DIS3 like exosome 3'-5' exoribonuclease
Synonyms
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R4977 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 64306756-64341288 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 64307201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 919 (S919A)
Ref Sequence ENSEMBL: ENSMUSP00000113503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034964] [ENSMUST00000068367] [ENSMUST00000113890] [ENSMUST00000120760] [ENSMUST00000168844] [ENSMUST00000216594]
AlphaFold Q8C0S1
Predicted Effect probably benign
Transcript: ENSMUST00000034964
SMART Domains Protein: ENSMUSP00000034964
Gene: ENSMUSG00000032397

DomainStartEndE-ValueType
low complexity region 19 43 N/A INTRINSIC
Pfam:Swi3 63 143 2.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068367
AA Change: S919A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000063830
Gene: ENSMUSG00000032396
AA Change: S919A

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113890
AA Change: S919A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109522
Gene: ENSMUSG00000032396
AA Change: S919A

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120760
AA Change: S919A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113503
Gene: ENSMUSG00000032396
AA Change: S919A

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168844
AA Change: S1002A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129772
Gene: ENSMUSG00000032396
AA Change: S1002A

DomainStartEndE-ValueType
low complexity region 208 220 N/A INTRINSIC
RNB 465 817 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216594
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic RNA exosome complex degrades unstable mRNAs and is involved in the regular turnover of other mRNAs. The protein encoded by this gene contains 3'-5' exoribonuclease activity and is a catalytic component of this complex. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Dis3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Dis3l APN 9 64319254 critical splice acceptor site probably null
IGL01812:Dis3l APN 9 64310237 missense probably benign 0.00
IGL01838:Dis3l APN 9 64308299 missense probably benign 0.41
IGL02104:Dis3l APN 9 64310329 missense possibly damaging 0.61
IGL02478:Dis3l APN 9 64314773 missense probably benign 0.00
IGL02481:Dis3l APN 9 64319080 splice site probably null
IGL02483:Dis3l APN 9 64319080 splice site probably null
IGL02965:Dis3l APN 9 64310484 missense probably damaging 0.99
IGL03139:Dis3l APN 9 64311950 missense probably damaging 0.99
IGL03054:Dis3l UTSW 9 64310440 critical splice donor site probably null
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0724:Dis3l UTSW 9 64307126 missense possibly damaging 0.92
R0801:Dis3l UTSW 9 64319154 missense probably benign
R0925:Dis3l UTSW 9 64341130 start codon destroyed probably null 0.97
R1502:Dis3l UTSW 9 64325787 missense possibly damaging 0.68
R1541:Dis3l UTSW 9 64307489 missense probably benign 0.07
R1794:Dis3l UTSW 9 64317776 missense possibly damaging 0.67
R1929:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2007:Dis3l UTSW 9 64308276 splice site probably null
R2062:Dis3l UTSW 9 64339573 missense probably benign 0.02
R2152:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2153:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2154:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2186:Dis3l UTSW 9 64339612 nonsense probably null
R2271:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2280:Dis3l UTSW 9 64317794 missense possibly damaging 0.70
R2287:Dis3l UTSW 9 64307497 missense probably benign 0.20
R3156:Dis3l UTSW 9 64311750 missense probably benign 0.25
R4664:Dis3l UTSW 9 64330798 missense unknown
R4775:Dis3l UTSW 9 64330908 missense probably benign 0.16
R4997:Dis3l UTSW 9 64311942 missense possibly damaging 0.76
R5097:Dis3l UTSW 9 64319216 missense probably damaging 1.00
R5579:Dis3l UTSW 9 64330835 missense probably benign 0.44
R5623:Dis3l UTSW 9 64307603 missense possibly damaging 0.70
R6310:Dis3l UTSW 9 64322575 missense probably benign 0.00
R6442:Dis3l UTSW 9 64307555 missense probably benign
R6505:Dis3l UTSW 9 64307513 missense probably benign 0.15
R6731:Dis3l UTSW 9 64310438 splice site probably null
R7008:Dis3l UTSW 9 64310453 missense possibly damaging 0.96
R7405:Dis3l UTSW 9 64314704 missense probably damaging 1.00
R7555:Dis3l UTSW 9 64311937 nonsense probably null
R7798:Dis3l UTSW 9 64341017 missense probably benign
R7890:Dis3l UTSW 9 64322471 missense probably benign 0.00
R8329:Dis3l UTSW 9 64311830 missense possibly damaging 0.50
R8715:Dis3l UTSW 9 64307060 missense probably benign
R8942:Dis3l UTSW 9 64307593 missense probably benign 0.22
R8973:Dis3l UTSW 9 64339542 missense probably damaging 0.96
R9189:Dis3l UTSW 9 64310449 missense probably benign 0.21
R9240:Dis3l UTSW 9 64310165 critical splice donor site probably null
R9354:Dis3l UTSW 9 64314640 missense probably benign 0.01
R9394:Dis3l UTSW 9 64317735 missense probably benign 0.24
X0020:Dis3l UTSW 9 64325734 missense probably damaging 1.00
X0065:Dis3l UTSW 9 64307054 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATGGAAGTATTTCACATTGCAC -3'
(R):5'- CTATTTGACCATGTGACGGTAAG -3'

Sequencing Primer
(F):5'- TTCACATTGCACAACTGTCAGAG -3'
(R):5'- GACGGTAAGTCTCTGCATTCAATG -3'
Posted On 2016-04-27