Incidental Mutation 'R4977:Ulbp1'
ID 382780
Institutional Source Beutler Lab
Gene Symbol Ulbp1
Ensembl Gene ENSMUSG00000079685
Gene Name UL16 binding protein 1
Synonyms A430108B07Rik, MULT1
MMRRC Submission 042572-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R4977 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 7394873-7423643 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7397391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 238 (R238H)
Ref Sequence ENSEMBL: ENSMUSP00000128204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169796] [ENSMUST00000177585] [ENSMUST00000218087]
AlphaFold Q8HWA3
Predicted Effect probably benign
Transcript: ENSMUST00000169796
AA Change: R238H

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128204
Gene: ENSMUSG00000079685
AA Change: R238H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PDB:1KCG|C 31 119 2e-7 PDB
transmembrane domain 124 146 N/A INTRINSIC
internal_repeat_1 148 174 1.72e-7 PROSPERO
internal_repeat_1 193 219 1.72e-7 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000177585
AA Change: R238H
SMART Domains Protein: ENSMUSP00000136637
Gene: ENSMUSG00000079685
AA Change: R238H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PDB:1KCG|C 46 204 7e-10 PDB
transmembrane domain 209 231 N/A INTRINSIC
internal_repeat_1 233 259 5.4e-7 PROSPERO
internal_repeat_1 278 304 5.4e-7 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000218087
AA Change: R153H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218736
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ligand of natural killer group 2, member D (NKG2D), an immune system-activating receptor on NK cells and T-cells. Binding of the encoded ligand to NKG2D leads to activation of several signal transduction pathways, including those of JAK2, STAT5, ERK and PI3K kinase/Akt. Also, in cytomegalovirus-infected cells, this ligand binds the UL16 glycoprotein and is prevented from activating the immune system. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,026,899 (GRCm39) D910G probably benign Het
Amy1 C T 3: 113,363,026 (GRCm39) probably null Het
C1s2 A G 6: 124,612,598 (GRCm39) M19T probably damaging Het
Cadps2 A G 6: 23,599,478 (GRCm39) I276T probably damaging Het
Cdyl2 A G 8: 117,302,008 (GRCm39) C458R probably damaging Het
Cep112 T C 11: 108,325,062 (GRCm39) S35P probably damaging Het
Chd9 T C 8: 91,760,336 (GRCm39) L2027P possibly damaging Het
Clcn4 T A 7: 7,294,436 (GRCm39) I411F probably benign Het
Cyp3a57 T C 5: 145,286,236 (GRCm39) probably null Het
Dis3l A C 9: 64,214,483 (GRCm39) S919A probably benign Het
Dnah8 A G 17: 30,882,275 (GRCm39) T616A probably benign Het
Emx2 A G 19: 59,447,678 (GRCm39) T11A probably damaging Het
Fbxl18 A G 5: 142,871,840 (GRCm39) L465P probably damaging Het
Fbxw27 G A 9: 109,601,187 (GRCm39) T311I probably damaging Het
Fhip1b A T 7: 105,038,542 (GRCm39) D232E probably damaging Het
Fstl5 C T 3: 76,317,801 (GRCm39) Q156* probably null Het
Ggn G T 7: 28,871,621 (GRCm39) G334C probably damaging Het
Grik2 T C 10: 49,008,841 (GRCm39) N749D probably damaging Het
Helb A G 10: 119,946,786 (GRCm39) S176P probably benign Het
Hyal1 A G 9: 107,456,153 (GRCm39) D73G probably benign Het
Ifi205 C A 1: 173,842,574 (GRCm39) R374I probably benign Het
Ift172 A T 5: 31,429,460 (GRCm39) V567D possibly damaging Het
Ighv1-43 A T 12: 114,909,845 (GRCm39) S26T possibly damaging Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Jam3 A G 9: 27,009,669 (GRCm39) V309A probably damaging Het
Kcnh4 A T 11: 100,637,659 (GRCm39) L666Q probably damaging Het
Kcnk10 A G 12: 98,406,946 (GRCm39) V250A probably benign Het
Lama1 A G 17: 68,044,677 (GRCm39) Y192C probably damaging Het
Lamb2 G A 9: 108,364,846 (GRCm39) R1200H probably damaging Het
Lilra6 T G 7: 3,917,382 (GRCm39) R204S probably benign Het
Lrrn1 A G 6: 107,545,668 (GRCm39) I489V probably benign Het
Mdh2 T A 5: 135,812,263 (GRCm39) D57E probably damaging Het
Mfsd2a A G 4: 122,844,302 (GRCm39) S282P probably benign Het
Midn T A 10: 79,986,018 (GRCm39) I36N probably damaging Het
Mpped1 A T 15: 83,680,907 (GRCm39) probably benign Het
Myh10 A G 11: 68,689,197 (GRCm39) D1258G possibly damaging Het
Nup62 T C 7: 44,478,449 (GRCm39) S155P possibly damaging Het
Or2g7 A T 17: 38,378,638 (GRCm39) H192L possibly damaging Het
Or2t46 A G 11: 58,472,455 (GRCm39) T262A possibly damaging Het
Or52ab7 A T 7: 102,978,040 (GRCm39) M116L probably benign Het
Pex7 T C 10: 19,745,078 (GRCm39) T258A probably benign Het
Plg A G 17: 12,621,976 (GRCm39) D432G probably damaging Het
Plxnd1 A T 6: 115,971,337 (GRCm39) S144T probably damaging Het
Prkch T C 12: 73,749,667 (GRCm39) F420S possibly damaging Het
Psg26 A G 7: 18,209,235 (GRCm39) V391A probably benign Het
Psg29 G A 7: 16,942,556 (GRCm39) G186R probably damaging Het
Rev3l T A 10: 39,699,574 (GRCm39) I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,123 (GRCm39) probably benign Het
Runx1 T A 16: 92,441,235 (GRCm39) probably null Het
Sapcd1 A T 17: 35,245,427 (GRCm39) S119T possibly damaging Het
Sema5a T A 15: 32,679,332 (GRCm39) N870K probably damaging Het
Serpina3f G A 12: 104,183,314 (GRCm39) E59K probably benign Het
Slc8b1 A G 5: 120,662,352 (GRCm39) K299E possibly damaging Het
Slco1b2 G A 6: 141,603,283 (GRCm39) M221I probably benign Het
Smg5 C T 3: 88,263,032 (GRCm39) Q812* probably null Het
Smr3a T G 5: 88,155,962 (GRCm39) probably null Het
Syt9 G A 7: 107,103,479 (GRCm39) D426N probably damaging Het
Tcf25 T C 8: 124,115,374 (GRCm39) Y204H probably benign Het
Tmeff2 T A 1: 51,018,715 (GRCm39) C232* probably null Het
Tmem184a C A 5: 139,793,757 (GRCm39) G219V probably null Het
Tnc G T 4: 63,924,485 (GRCm39) T1071K possibly damaging Het
Tnn C A 1: 159,948,188 (GRCm39) G842W probably damaging Het
Tshz3 T A 7: 36,470,615 (GRCm39) I868N probably benign Het
Ushbp1 C T 8: 71,847,693 (GRCm39) probably null Het
Usp34 G C 11: 23,438,982 (GRCm39) D3515H probably damaging Het
Wdr91 T C 6: 34,887,726 (GRCm39) E10G probably damaging Het
Xdh A T 17: 74,205,965 (GRCm39) F1016L probably benign Het
Zfp235 T G 7: 23,841,609 (GRCm39) I676S possibly damaging Het
Zfp619 G A 7: 39,186,811 (GRCm39) C947Y probably damaging Het
Zfp663 A G 2: 165,195,731 (GRCm39) S163P probably damaging Het
Zfp93 A G 7: 23,974,836 (GRCm39) I274V probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Ulbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1463:Ulbp1 UTSW 10 7,396,557 (GRCm39) splice site probably benign
R2309:Ulbp1 UTSW 10 7,397,388 (GRCm39) missense probably benign 0.03
R4486:Ulbp1 UTSW 10 7,397,397 (GRCm39) missense probably benign 0.03
R4542:Ulbp1 UTSW 10 7,406,570 (GRCm39) missense probably damaging 1.00
R5568:Ulbp1 UTSW 10 7,423,281 (GRCm39) missense unknown
R7705:Ulbp1 UTSW 10 7,395,685 (GRCm39) missense unknown
R7943:Ulbp1 UTSW 10 7,407,053 (GRCm39) missense probably damaging 0.98
R9177:Ulbp1 UTSW 10 7,396,392 (GRCm39) missense unknown
R9268:Ulbp1 UTSW 10 7,396,392 (GRCm39) missense unknown
R9495:Ulbp1 UTSW 10 7,406,371 (GRCm39) missense probably benign 0.03
R9502:Ulbp1 UTSW 10 7,423,260 (GRCm39) missense probably benign 0.19
RF009:Ulbp1 UTSW 10 7,397,405 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATACTCACCTCTAACATTGCTGTG -3'
(R):5'- GCAGGGTTTGGTAAATAGTTCTCAC -3'

Sequencing Primer
(F):5'- CTCACCTCTAACATTGCTGTGAAGAG -3'
(R):5'- GGTTTGGTAAATAGTTCTCACAAAGG -3'
Posted On 2016-04-27