Mutagenetix > Incidental Mutation

Incidental Mutation 'R4977:Grik2'

382783

Institutional Source

Beutler Lab

Gene Symbol

Grik2

Ensembl Gene

ENSMUSG00000056073

Gene Name

glutamate receptor, ionotropic, kainate 2 (beta 2)

Synonyms

Glurbeta2, Glur-6, Glur6

MMRRC Submission

042572-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4977 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49094833-49788766 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49132745 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 749 (N749D)

Ref Sequence

ENSEMBL: ENSMUSP00000151389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218823]

AlphaFold

P39087

Predicted Effect

probably damaging
Transcript: ENSMUST00000079751
AA Change: N749D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: N749D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000105484
AA Change: N749D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: N749D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000105485
AA Change: N749D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: N749D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000105486
AA Change: N749D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: N749D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	3.8e-11	PFAM
Pfam:ANF_receptor	52	395	1.5e-74	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	6e-13	BLAST
low complexity region	875	891	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105487
AA Change: N749D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: N749D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147808

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217673

Predicted Effect

probably damaging
Transcript: ENSMUST00000218441
AA Change: N749D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218598
AA Change: N749D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218823
AA Change: N749D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

unknown
Transcript: ENSMUST00000219509
AA Change: N188D

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,136,073	D910G	probably benign	Het
Amy1	C	T	3: 113,569,377		probably null	Het
C1s2	A	G	6: 124,635,639	M19T	probably damaging	Het
Cadps2	A	G	6: 23,599,479	I276T	probably damaging	Het
Cdyl2	A	G	8: 116,575,269	C458R	probably damaging	Het
Cep112	T	C	11: 108,434,236	S35P	probably damaging	Het
Chd9	T	C	8: 91,033,708	L2027P	possibly damaging	Het
Clcn4	T	A	7: 7,291,437	I411F	probably benign	Het
Cyp3a57	T	C	5: 145,349,426		probably null	Het
Dis3l	A	C	9: 64,307,201	S919A	probably benign	Het
Dnah8	A	G	17: 30,663,301	T616A	probably benign	Het
Emx2	A	G	19: 59,459,246	T11A	probably damaging	Het
Fam160a2	A	T	7: 105,389,335	D232E	probably damaging	Het
Fbxl18	A	G	5: 142,886,085	L465P	probably damaging	Het
Fbxw27	G	A	9: 109,772,119	T311I	probably damaging	Het
Fstl5	C	T	3: 76,410,494	Q156*	probably null	Het
Ggn	G	T	7: 29,172,196	G334C	probably damaging	Het
Helb	A	G	10: 120,110,881	S176P	probably benign	Het
Hyal1	A	G	9: 107,578,954	D73G	probably benign	Het
Ifi205	C	A	1: 174,015,008	R374I	probably benign	Het
Ift172	A	T	5: 31,272,116	V567D	possibly damaging	Het
Ighv1-43	A	T	12: 114,946,225	S26T	possibly damaging	Het
Il21	C	A	3: 37,232,504	S21I	probably damaging	Het
Jam3	A	G	9: 27,098,373	V309A	probably damaging	Het
Kcnh4	A	T	11: 100,746,833	L666Q	probably damaging	Het
Kcnk10	A	G	12: 98,440,687	V250A	probably benign	Het
Lama1	A	G	17: 67,737,682	Y192C	probably damaging	Het
Lamb2	G	A	9: 108,487,647	R1200H	probably damaging	Het
Lilra6	T	G	7: 3,914,383	R204S	probably benign	Het
Lrrn1	A	G	6: 107,568,707	I489V	probably benign	Het
Mdh2	T	A	5: 135,783,409	D57E	probably damaging	Het
Mfsd2a	A	G	4: 122,950,509	S282P	probably benign	Het
Midn	T	A	10: 80,150,184	I36N	probably damaging	Het
Mpped1	A	T	15: 83,796,706		probably benign	Het
Myh10	A	G	11: 68,798,371	D1258G	possibly damaging	Het
Nup62	T	C	7: 44,829,025	S155P	possibly damaging	Het
Olfr130	A	T	17: 38,067,747	H192L	possibly damaging	Het
Olfr325	A	G	11: 58,581,629	T262A	possibly damaging	Het
Olfr598	A	T	7: 103,328,833	M116L	probably benign	Het
Pex7	T	C	10: 19,869,332	T258A	probably benign	Het
Plg	A	G	17: 12,403,089	D432G	probably damaging	Het
Plxnd1	A	T	6: 115,994,376	S144T	probably damaging	Het
Prkch	T	C	12: 73,702,893	F420S	possibly damaging	Het
Psg26	A	G	7: 18,475,310	V391A	probably benign	Het
Psg29	G	A	7: 17,208,631	G186R	probably damaging	Het
Rev3l	T	A	10: 39,823,578	I1357K	possibly damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,916		probably benign	Het
Runx1	T	A	16: 92,644,347		probably null	Het
Sapcd1	A	T	17: 35,026,451	S119T	possibly damaging	Het
Sema5a	T	A	15: 32,679,186	N870K	probably damaging	Het
Serpina3f	G	A	12: 104,217,055	E59K	probably benign	Het
Slc8b1	A	G	5: 120,524,287	K299E	possibly damaging	Het
Slco1b2	G	A	6: 141,657,557	M221I	probably benign	Het
Smg5	C	T	3: 88,355,725	Q812*	probably null	Het
Smr3a	T	G	5: 88,008,103		probably null	Het
Syt9	G	A	7: 107,504,272	D426N	probably damaging	Het
Tcf25	T	C	8: 123,388,635	Y204H	probably benign	Het
Tmeff2	T	A	1: 50,979,556	C232*	probably null	Het
Tmem184a	C	A	5: 139,808,002	G219V	probably null	Het
Tnc	G	T	4: 64,006,248	T1071K	possibly damaging	Het
Tnn	C	A	1: 160,120,618	G842W	probably damaging	Het
Tshz3	T	A	7: 36,771,190	I868N	probably benign	Het
Ulbp1	C	T	10: 7,447,391	R238H	probably benign	Het
Ushbp1	C	T	8: 71,395,049		probably null	Het
Usp34	G	C	11: 23,488,982	D3515H	probably damaging	Het
Wdr91	T	C	6: 34,910,791	E10G	probably damaging	Het
Xdh	A	T	17: 73,898,970	F1016L	probably benign	Het
Zfp235	T	G	7: 24,142,184	I676S	possibly damaging	Het
Zfp619	G	A	7: 39,537,387	C947Y	probably damaging	Het
Zfp663	A	G	2: 165,353,811	S163P	probably damaging	Het
Zfp93	A	G	7: 24,275,411	I274V	probably benign	Het
Zswim4	C	T	8: 84,226,667		probably null	Het

Other mutations in Grik2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Grik2	APN	10	49355928	missense	possibly damaging	0.95
IGL00979:Grik2	APN	10	49355938	missense	probably damaging	1.00
IGL01012:Grik2	APN	10	49272956	missense	probably damaging	1.00
IGL01302:Grik2	APN	10	49244330	missense	probably damaging	0.99
IGL01657:Grik2	APN	10	49527986	critical splice donor site	probably null
IGL02162:Grik2	APN	10	49422575	missense	possibly damaging	0.77
IGL02317:Grik2	APN	10	49422615	missense	probably benign	0.16
IGL02512:Grik2	APN	10	49355912	missense	probably benign	0.00
IGL02650:Grik2	APN	10	49101235	missense	probably benign	0.03
IGL03283:Grik2	APN	10	49578269	missense	probably benign	0.00
BB004:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
BB014:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R0325:Grik2	UTSW	10	49240725	missense	probably damaging	1.00
R0492:Grik2	UTSW	10	49101164	missense	probably damaging	0.99
R0601:Grik2	UTSW	10	49422597	missense	probably damaging	1.00
R0844:Grik2	UTSW	10	49101115	missense	possibly damaging	0.81
R1333:Grik2	UTSW	10	49527991	missense	probably damaging	0.98
R1499:Grik2	UTSW	10	49132775	missense	probably damaging	1.00
R1660:Grik2	UTSW	10	49244343	nonsense	probably null
R1721:Grik2	UTSW	10	49523746	missense	possibly damaging	0.93
R1966:Grik2	UTSW	10	49355909	missense	probably damaging	1.00
R1974:Grik2	UTSW	10	49132827	missense	possibly damaging	0.85
R2246:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R3103:Grik2	UTSW	10	49240772	missense	probably damaging	1.00
R3974:Grik2	UTSW	10	49422654	missense	probably damaging	1.00
R4592:Grik2	UTSW	10	49422615	missense	possibly damaging	0.48
R4658:Grik2	UTSW	10	49523792	missense	possibly damaging	0.71
R4748:Grik2	UTSW	10	49535341	missense	possibly damaging	0.87
R4935:Grik2	UTSW	10	49240730	missense	probably damaging	1.00
R5103:Grik2	UTSW	10	49496109	missense	probably benign	0.33
R5330:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5331:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5736:Grik2	UTSW	10	49404410	missense	probably damaging	0.96
R5740:Grik2	UTSW	10	49113477	missense	probably damaging	0.99
R5747:Grik2	UTSW	10	49523774	missense	probably benign
R6015:Grik2	UTSW	10	49523863	splice site	probably null
R6311:Grik2	UTSW	10	49578138	missense	probably damaging	0.98
R6474:Grik2	UTSW	10	49132680	missense	probably benign
R6504:Grik2	UTSW	10	49356102	missense	probably damaging	1.00
R6591:Grik2	UTSW	10	49272925	nonsense	probably null
R6691:Grik2	UTSW	10	49272925	nonsense	probably null
R6776:Grik2	UTSW	10	49355989	missense	probably damaging	1.00
R7015:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R7094:Grik2	UTSW	10	49355916	missense	possibly damaging	0.75
R7153:Grik2	UTSW	10	49535367	missense	probably benign	0.00
R7229:Grik2	UTSW	10	49101416	splice site	probably null
R7402:Grik2	UTSW	10	49535397	missense	probably damaging	1.00
R7473:Grik2	UTSW	10	49113522	missense	probably benign	0.22
R7514:Grik2	UTSW	10	49523808	missense	probably damaging	0.99
R7526:Grik2	UTSW	10	49523822	missense	possibly damaging	0.56
R7657:Grik2	UTSW	10	49783151	missense	probably benign	0.11
R7681:Grik2	UTSW	10	49244380	missense	probably damaging	1.00
R7714:Grik2	UTSW	10	49419696	missense	probably damaging	0.97
R7927:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R7952:Grik2	UTSW	10	49422537	missense	probably benign	0.15
R7979:Grik2	UTSW	10	49404342	missense	probably benign	0.01
R8062:Grik2	UTSW	10	49240767	missense	probably damaging	1.00
R8222:Grik2	UTSW	10	49573648	missense	probably benign	0.29
R8406:Grik2	UTSW	10	49272767	missense	probably damaging	1.00
R9017:Grik2	UTSW	10	49113459	missense	possibly damaging	0.94
R9557:Grik2	UTSW	10	49528009	missense	probably damaging	1.00
RF008:Grik2	UTSW	10	49244384	missense	probably damaging	1.00
X0062:Grik2	UTSW	10	49272920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTTTGGAGCCTGAGACC -3'
(R):5'- ATGTAGGATTCTGTAGAGCCTAAG -3'

Sequencing Primer
(F):5'- GAGACCGGTTTGCCCATTTTTAATC -3'
(R):5'- GAGACAGTCTGTGCTTGT -3'

Posted On

2016-04-27