Incidental Mutation 'R4977:Usp34'
ID 382786
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 042572-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R4977 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 23438982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Histidine at position 3515 (D3515H)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000128559] [ENSMUST00000180046] [ENSMUST00000147157] [ENSMUST00000129368]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020529
SMART Domains Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 163 2.52e-57 SMART
Pfam:AHSA1 209 325 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109539
SMART Domains Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 2 115 2.33e-38 SMART
Pfam:AHSA1 161 277 4.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125701
Predicted Effect probably benign
Transcript: ENSMUST00000128372
SMART Domains Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 15 149 2.52e-57 SMART
Pfam:AHSA1 195 311 7.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128559
SMART Domains Protein: ENSMUSP00000115134
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 159 1.59e-54 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: D3534H
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: D3534H

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180046
AA Change: D3515H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: D3515H

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153409
Predicted Effect probably benign
Transcript: ENSMUST00000147157
SMART Domains Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 138 4.15e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129368
SMART Domains Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
Blast:Drf_GBD 2 86 1e-19 BLAST
low complexity region 231 244 N/A INTRINSIC
coiled coil region 259 281 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,026,899 (GRCm39) D910G probably benign Het
Amy1 C T 3: 113,363,026 (GRCm39) probably null Het
C1s2 A G 6: 124,612,598 (GRCm39) M19T probably damaging Het
Cadps2 A G 6: 23,599,478 (GRCm39) I276T probably damaging Het
Cdyl2 A G 8: 117,302,008 (GRCm39) C458R probably damaging Het
Cep112 T C 11: 108,325,062 (GRCm39) S35P probably damaging Het
Chd9 T C 8: 91,760,336 (GRCm39) L2027P possibly damaging Het
Clcn4 T A 7: 7,294,436 (GRCm39) I411F probably benign Het
Cyp3a57 T C 5: 145,286,236 (GRCm39) probably null Het
Dis3l A C 9: 64,214,483 (GRCm39) S919A probably benign Het
Dnah8 A G 17: 30,882,275 (GRCm39) T616A probably benign Het
Emx2 A G 19: 59,447,678 (GRCm39) T11A probably damaging Het
Fbxl18 A G 5: 142,871,840 (GRCm39) L465P probably damaging Het
Fbxw27 G A 9: 109,601,187 (GRCm39) T311I probably damaging Het
Fhip1b A T 7: 105,038,542 (GRCm39) D232E probably damaging Het
Fstl5 C T 3: 76,317,801 (GRCm39) Q156* probably null Het
Ggn G T 7: 28,871,621 (GRCm39) G334C probably damaging Het
Grik2 T C 10: 49,008,841 (GRCm39) N749D probably damaging Het
Helb A G 10: 119,946,786 (GRCm39) S176P probably benign Het
Hyal1 A G 9: 107,456,153 (GRCm39) D73G probably benign Het
Ifi205 C A 1: 173,842,574 (GRCm39) R374I probably benign Het
Ift172 A T 5: 31,429,460 (GRCm39) V567D possibly damaging Het
Ighv1-43 A T 12: 114,909,845 (GRCm39) S26T possibly damaging Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Jam3 A G 9: 27,009,669 (GRCm39) V309A probably damaging Het
Kcnh4 A T 11: 100,637,659 (GRCm39) L666Q probably damaging Het
Kcnk10 A G 12: 98,406,946 (GRCm39) V250A probably benign Het
Lama1 A G 17: 68,044,677 (GRCm39) Y192C probably damaging Het
Lamb2 G A 9: 108,364,846 (GRCm39) R1200H probably damaging Het
Lilra6 T G 7: 3,917,382 (GRCm39) R204S probably benign Het
Lrrn1 A G 6: 107,545,668 (GRCm39) I489V probably benign Het
Mdh2 T A 5: 135,812,263 (GRCm39) D57E probably damaging Het
Mfsd2a A G 4: 122,844,302 (GRCm39) S282P probably benign Het
Midn T A 10: 79,986,018 (GRCm39) I36N probably damaging Het
Mpped1 A T 15: 83,680,907 (GRCm39) probably benign Het
Myh10 A G 11: 68,689,197 (GRCm39) D1258G possibly damaging Het
Nup62 T C 7: 44,478,449 (GRCm39) S155P possibly damaging Het
Or2g7 A T 17: 38,378,638 (GRCm39) H192L possibly damaging Het
Or2t46 A G 11: 58,472,455 (GRCm39) T262A possibly damaging Het
Or52ab7 A T 7: 102,978,040 (GRCm39) M116L probably benign Het
Pex7 T C 10: 19,745,078 (GRCm39) T258A probably benign Het
Plg A G 17: 12,621,976 (GRCm39) D432G probably damaging Het
Plxnd1 A T 6: 115,971,337 (GRCm39) S144T probably damaging Het
Prkch T C 12: 73,749,667 (GRCm39) F420S possibly damaging Het
Psg26 A G 7: 18,209,235 (GRCm39) V391A probably benign Het
Psg29 G A 7: 16,942,556 (GRCm39) G186R probably damaging Het
Rev3l T A 10: 39,699,574 (GRCm39) I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,123 (GRCm39) probably benign Het
Runx1 T A 16: 92,441,235 (GRCm39) probably null Het
Sapcd1 A T 17: 35,245,427 (GRCm39) S119T possibly damaging Het
Sema5a T A 15: 32,679,332 (GRCm39) N870K probably damaging Het
Serpina3f G A 12: 104,183,314 (GRCm39) E59K probably benign Het
Slc8b1 A G 5: 120,662,352 (GRCm39) K299E possibly damaging Het
Slco1b2 G A 6: 141,603,283 (GRCm39) M221I probably benign Het
Smg5 C T 3: 88,263,032 (GRCm39) Q812* probably null Het
Smr3a T G 5: 88,155,962 (GRCm39) probably null Het
Syt9 G A 7: 107,103,479 (GRCm39) D426N probably damaging Het
Tcf25 T C 8: 124,115,374 (GRCm39) Y204H probably benign Het
Tmeff2 T A 1: 51,018,715 (GRCm39) C232* probably null Het
Tmem184a C A 5: 139,793,757 (GRCm39) G219V probably null Het
Tnc G T 4: 63,924,485 (GRCm39) T1071K possibly damaging Het
Tnn C A 1: 159,948,188 (GRCm39) G842W probably damaging Het
Tshz3 T A 7: 36,470,615 (GRCm39) I868N probably benign Het
Ulbp1 C T 10: 7,397,391 (GRCm39) R238H probably benign Het
Ushbp1 C T 8: 71,847,693 (GRCm39) probably null Het
Wdr91 T C 6: 34,887,726 (GRCm39) E10G probably damaging Het
Xdh A T 17: 74,205,965 (GRCm39) F1016L probably benign Het
Zfp235 T G 7: 23,841,609 (GRCm39) I676S possibly damaging Het
Zfp619 G A 7: 39,186,811 (GRCm39) C947Y probably damaging Het
Zfp663 A G 2: 165,195,731 (GRCm39) S163P probably damaging Het
Zfp93 A G 7: 23,974,836 (GRCm39) I274V probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTGAAAACAGCTCTGTC -3'
(R):5'- TGCCAGATATCCTTGTGACCAC -3'

Sequencing Primer
(F):5'- GGAAGGCCCATCTTCATTTTCAGAAG -3'
(R):5'- GACCACATGGATTGTTGATTCAATGG -3'
Posted On 2016-04-27