Incidental Mutation 'R4977:Plg'
ID 382802
Institutional Source Beutler Lab
Gene Symbol Plg
Ensembl Gene ENSMUSG00000059481
Gene Name plasminogen
Synonyms Pg
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock # R4977 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 12378609-12419384 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12403089 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 432 (D432G)
Ref Sequence ENSEMBL: ENSMUSP00000014578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014578]
AlphaFold P20918
Predicted Effect probably damaging
Transcript: ENSMUST00000014578
AA Change: D432G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014578
Gene: ENSMUSG00000059481
AA Change: D432G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PAN_AP 20 97 8.67e-14 SMART
KR 101 183 1.31e-41 SMART
KR 184 264 5.4e-43 SMART
KR 273 354 3.45e-50 SMART
KR 375 456 3.9e-49 SMART
KR 479 562 5.53e-40 SMART
Tryp_SPc 581 805 4.11e-94 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted blood zymogen that is activated by proteolysis and converted to plasmin and angiostatin. Plasmin dissolves fibrin in blood clots and is an important protease in many other cellular processes while angiostatin inhibits angiogenesis. Defects in this gene are likely a cause of thrombophilia and ligneous conjunctivitis. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous null mutants exhibit retarded growth, variable rectal prolapse, impaired fertility and lactation in females, early mortality, and widespread fibrin deposition and thrombotic lesions in liver, lung, stomach and other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Plg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Plg APN 17 12411493 missense probably damaging 1.00
IGL01128:Plg APN 17 12396699 splice site probably benign
IGL01522:Plg APN 17 12404069 missense probably damaging 1.00
IGL01981:Plg APN 17 12403047 splice site probably benign
IGL03338:Plg APN 17 12419072 missense probably damaging 1.00
R0391:Plg UTSW 17 12419081 missense probably damaging 1.00
R0531:Plg UTSW 17 12411447 splice site probably benign
R0646:Plg UTSW 17 12418736 missense probably damaging 1.00
R0759:Plg UTSW 17 12410951 missense probably damaging 1.00
R1013:Plg UTSW 17 12378721 splice site probably benign
R2116:Plg UTSW 17 12384477 missense probably damaging 0.99
R2442:Plg UTSW 17 12410960 missense probably benign 0.15
R2512:Plg UTSW 17 12403229 missense probably benign
R2879:Plg UTSW 17 12404100 missense possibly damaging 0.92
R3107:Plg UTSW 17 12384429 missense probably benign 0.00
R3405:Plg UTSW 17 12403209 missense possibly damaging 0.65
R4409:Plg UTSW 17 12390263 missense probably damaging 1.00
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4990:Plg UTSW 17 12411510 missense probably benign
R5319:Plg UTSW 17 12403227 missense possibly damaging 0.49
R5443:Plg UTSW 17 12382183 missense probably benign 0.03
R5635:Plg UTSW 17 12395754 missense probably damaging 1.00
R5981:Plg UTSW 17 12378718 critical splice donor site probably null
R6166:Plg UTSW 17 12398114 missense probably damaging 0.99
R6688:Plg UTSW 17 12391845 missense probably damaging 1.00
R6726:Plg UTSW 17 12378708 missense probably damaging 1.00
R6995:Plg UTSW 17 12419051 missense probably benign 0.00
R7028:Plg UTSW 17 12391836 missense probably damaging 1.00
R7168:Plg UTSW 17 12388559 missense probably damaging 1.00
R7356:Plg UTSW 17 12410911 missense probably damaging 1.00
R8902:Plg UTSW 17 12410903 missense probably benign 0.32
R9035:Plg UTSW 17 12390220 nonsense probably null
Z1176:Plg UTSW 17 12414185 missense probably benign 0.02
Z1177:Plg UTSW 17 12403233 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGACCATTTGTGACAATGCATTG -3'
(R):5'- TGGGAGCTTCTACATAAGTAGC -3'

Sequencing Primer
(F):5'- GGGAGCTAAATTCTGCCA -3'
(R):5'- GTGTCCAGTCTCCACAGCTG -3'
Posted On 2016-04-27