Incidental Mutation 'R4977:Xdh'
ID 382807
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 042572-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R4977 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74205965 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1016 (F1016L)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: F1016L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: F1016L

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,026,899 (GRCm39) D910G probably benign Het
Amy1 C T 3: 113,363,026 (GRCm39) probably null Het
C1s2 A G 6: 124,612,598 (GRCm39) M19T probably damaging Het
Cadps2 A G 6: 23,599,478 (GRCm39) I276T probably damaging Het
Cdyl2 A G 8: 117,302,008 (GRCm39) C458R probably damaging Het
Cep112 T C 11: 108,325,062 (GRCm39) S35P probably damaging Het
Chd9 T C 8: 91,760,336 (GRCm39) L2027P possibly damaging Het
Clcn4 T A 7: 7,294,436 (GRCm39) I411F probably benign Het
Cyp3a57 T C 5: 145,286,236 (GRCm39) probably null Het
Dis3l A C 9: 64,214,483 (GRCm39) S919A probably benign Het
Dnah8 A G 17: 30,882,275 (GRCm39) T616A probably benign Het
Emx2 A G 19: 59,447,678 (GRCm39) T11A probably damaging Het
Fbxl18 A G 5: 142,871,840 (GRCm39) L465P probably damaging Het
Fbxw27 G A 9: 109,601,187 (GRCm39) T311I probably damaging Het
Fhip1b A T 7: 105,038,542 (GRCm39) D232E probably damaging Het
Fstl5 C T 3: 76,317,801 (GRCm39) Q156* probably null Het
Ggn G T 7: 28,871,621 (GRCm39) G334C probably damaging Het
Grik2 T C 10: 49,008,841 (GRCm39) N749D probably damaging Het
Helb A G 10: 119,946,786 (GRCm39) S176P probably benign Het
Hyal1 A G 9: 107,456,153 (GRCm39) D73G probably benign Het
Ifi205 C A 1: 173,842,574 (GRCm39) R374I probably benign Het
Ift172 A T 5: 31,429,460 (GRCm39) V567D possibly damaging Het
Ighv1-43 A T 12: 114,909,845 (GRCm39) S26T possibly damaging Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Jam3 A G 9: 27,009,669 (GRCm39) V309A probably damaging Het
Kcnh4 A T 11: 100,637,659 (GRCm39) L666Q probably damaging Het
Kcnk10 A G 12: 98,406,946 (GRCm39) V250A probably benign Het
Lama1 A G 17: 68,044,677 (GRCm39) Y192C probably damaging Het
Lamb2 G A 9: 108,364,846 (GRCm39) R1200H probably damaging Het
Lilra6 T G 7: 3,917,382 (GRCm39) R204S probably benign Het
Lrrn1 A G 6: 107,545,668 (GRCm39) I489V probably benign Het
Mdh2 T A 5: 135,812,263 (GRCm39) D57E probably damaging Het
Mfsd2a A G 4: 122,844,302 (GRCm39) S282P probably benign Het
Midn T A 10: 79,986,018 (GRCm39) I36N probably damaging Het
Mpped1 A T 15: 83,680,907 (GRCm39) probably benign Het
Myh10 A G 11: 68,689,197 (GRCm39) D1258G possibly damaging Het
Nup62 T C 7: 44,478,449 (GRCm39) S155P possibly damaging Het
Or2g7 A T 17: 38,378,638 (GRCm39) H192L possibly damaging Het
Or2t46 A G 11: 58,472,455 (GRCm39) T262A possibly damaging Het
Or52ab7 A T 7: 102,978,040 (GRCm39) M116L probably benign Het
Pex7 T C 10: 19,745,078 (GRCm39) T258A probably benign Het
Plg A G 17: 12,621,976 (GRCm39) D432G probably damaging Het
Plxnd1 A T 6: 115,971,337 (GRCm39) S144T probably damaging Het
Prkch T C 12: 73,749,667 (GRCm39) F420S possibly damaging Het
Psg26 A G 7: 18,209,235 (GRCm39) V391A probably benign Het
Psg29 G A 7: 16,942,556 (GRCm39) G186R probably damaging Het
Rev3l T A 10: 39,699,574 (GRCm39) I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,123 (GRCm39) probably benign Het
Runx1 T A 16: 92,441,235 (GRCm39) probably null Het
Sapcd1 A T 17: 35,245,427 (GRCm39) S119T possibly damaging Het
Sema5a T A 15: 32,679,332 (GRCm39) N870K probably damaging Het
Serpina3f G A 12: 104,183,314 (GRCm39) E59K probably benign Het
Slc8b1 A G 5: 120,662,352 (GRCm39) K299E possibly damaging Het
Slco1b2 G A 6: 141,603,283 (GRCm39) M221I probably benign Het
Smg5 C T 3: 88,263,032 (GRCm39) Q812* probably null Het
Smr3a T G 5: 88,155,962 (GRCm39) probably null Het
Syt9 G A 7: 107,103,479 (GRCm39) D426N probably damaging Het
Tcf25 T C 8: 124,115,374 (GRCm39) Y204H probably benign Het
Tmeff2 T A 1: 51,018,715 (GRCm39) C232* probably null Het
Tmem184a C A 5: 139,793,757 (GRCm39) G219V probably null Het
Tnc G T 4: 63,924,485 (GRCm39) T1071K possibly damaging Het
Tnn C A 1: 159,948,188 (GRCm39) G842W probably damaging Het
Tshz3 T A 7: 36,470,615 (GRCm39) I868N probably benign Het
Ulbp1 C T 10: 7,397,391 (GRCm39) R238H probably benign Het
Ushbp1 C T 8: 71,847,693 (GRCm39) probably null Het
Usp34 G C 11: 23,438,982 (GRCm39) D3515H probably damaging Het
Wdr91 T C 6: 34,887,726 (GRCm39) E10G probably damaging Het
Zfp235 T G 7: 23,841,609 (GRCm39) I676S possibly damaging Het
Zfp619 G A 7: 39,186,811 (GRCm39) C947Y probably damaging Het
Zfp663 A G 2: 165,195,731 (GRCm39) S163P probably damaging Het
Zfp93 A G 7: 23,974,836 (GRCm39) I274V probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTACACTAGCAGCAATATGC -3'
(R):5'- CTTTCAAGGATCTGTTCTGACTTAAT -3'

Sequencing Primer
(F):5'- GCAAATTTTATTTCAGAAGCAGAGAG -3'
(R):5'- GAGTGAGGCCTTGAATGT -3'
Posted On 2016-04-27