Incidental Mutation 'R4939:Nup214'
ID382882
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Namenucleoporin 214
SynonymsCAN, D2H9S46E
MMRRC Submission 042538-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4939 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31974436-32053975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31983159 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 255 (T255K)
Ref Sequence ENSEMBL: ENSMUSP00000066492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398]
Predicted Effect probably benign
Transcript: ENSMUST00000065398
AA Change: T255K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: T255K

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130975
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dnajc21 T A 15: 10,449,597 D446V probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Heatr5b T C 17: 78,762,260 E1686G probably benign Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Lepr A T 4: 101,733,438 K71I possibly damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Ncapd3 T C 9: 27,063,869 probably null Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Orc3 G A 4: 34,593,126 Q256* probably null Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Plxna4 T C 6: 32,165,762 Y1586C probably damaging Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Rrm1 T C 7: 102,466,924 V683A probably benign Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shank1 C T 7: 44,326,162 P477S unknown Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 32033979 missense probably damaging 1.00
IGL00649:Nup214 APN 2 32006721 missense probably benign 0.27
IGL01149:Nup214 APN 2 32034700 missense probably damaging 1.00
IGL01360:Nup214 APN 2 32038178 unclassified probably benign
IGL01409:Nup214 APN 2 32026931 splice site probably null
IGL01530:Nup214 APN 2 32033721 missense probably benign
IGL01554:Nup214 APN 2 32051072 nonsense probably null
IGL01944:Nup214 APN 2 32034959 nonsense probably null
IGL02296:Nup214 APN 2 31988188 missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31977860 missense probably damaging 1.00
IGL02688:Nup214 APN 2 32031275 missense probably benign
IGL02858:Nup214 APN 2 32010372 splice site probably benign
IGL02953:Nup214 APN 2 31988229 missense possibly damaging 0.87
IGL03090:Nup214 APN 2 32018242 missense probably benign 0.01
IGL03124:Nup214 APN 2 31996440 missense probably benign 0.27
IGL03225:Nup214 APN 2 32034411 missense probably damaging 1.00
IGL03375:Nup214 APN 2 32010221 missense probably damaging 0.97
Des_moines UTSW 2 31980584 splice site probably null
ANU74:Nup214 UTSW 2 32034966 missense probably damaging 0.99
R0035:Nup214 UTSW 2 31990367 splice site probably null
R0243:Nup214 UTSW 2 31998057 splice site probably benign
R0270:Nup214 UTSW 2 32034814 missense probably damaging 0.96
R0358:Nup214 UTSW 2 32004300 splice site probably null
R1168:Nup214 UTSW 2 32025301 missense probably benign
R1242:Nup214 UTSW 2 31977770 missense probably benign 0.00
R1481:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1482:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1579:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1580:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1581:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1610:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1894:Nup214 UTSW 2 31996380 missense possibly damaging 0.66
R2146:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2149:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2293:Nup214 UTSW 2 32026875 missense probably benign
R2924:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R2925:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R3037:Nup214 UTSW 2 31976620 missense probably benign 0.00
R3426:Nup214 UTSW 2 32033403 missense probably damaging 0.97
R3799:Nup214 UTSW 2 32034682 missense probably damaging 1.00
R3843:Nup214 UTSW 2 32051100 missense probably damaging 1.00
R4323:Nup214 UTSW 2 31994684 missense probably benign
R4353:Nup214 UTSW 2 31977917 critical splice donor site probably null
R4601:Nup214 UTSW 2 31997965 missense probably benign 0.36
R4626:Nup214 UTSW 2 32033404 missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31980584 splice site probably null
R4938:Nup214 UTSW 2 31983159 missense probably benign 0.00
R5027:Nup214 UTSW 2 31991317 missense probably damaging 1.00
R5358:Nup214 UTSW 2 32017146 missense unknown
R5406:Nup214 UTSW 2 32002607 missense probably damaging 0.96
R5507:Nup214 UTSW 2 31988176 missense possibly damaging 0.87
R5695:Nup214 UTSW 2 32034373 missense probably damaging 1.00
R5744:Nup214 UTSW 2 32010296 missense probably damaging 0.97
R5908:Nup214 UTSW 2 31991341 missense probably benign 0.03
R5967:Nup214 UTSW 2 31979778 missense possibly damaging 0.52
R6140:Nup214 UTSW 2 32051796 missense possibly damaging 0.92
R6243:Nup214 UTSW 2 32002932 missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31991372 missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31982671 nonsense probably null
R6970:Nup214 UTSW 2 32051798 missense probably damaging 1.00
R7028:Nup214 UTSW 2 32034156 missense probably benign 0.22
R7114:Nup214 UTSW 2 32025244 missense possibly damaging 0.83
R7120:Nup214 UTSW 2 32051042 missense probably benign 0.07
R7249:Nup214 UTSW 2 31988233 missense possibly damaging 0.92
R7821:Nup214 UTSW 2 32026905 missense possibly damaging 0.83
RF015:Nup214 UTSW 2 32034706 missense probably benign 0.00
X0026:Nup214 UTSW 2 32020306 missense possibly damaging 0.46
X0065:Nup214 UTSW 2 32042476 missense probably damaging 1.00
Z1088:Nup214 UTSW 2 32011223 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGATAGACCTTTGGTAAAGCCATAG -3'
(R):5'- CTTACCCCTGAGTCTACCATCACAG -3'

Sequencing Primer
(F):5'- TTGTAGCACATGGTGGCT -3'
(R):5'- TGAGTCTACCATCACAGCTACTAAGG -3'
Posted On2016-04-27