Incidental Mutation 'R0320:Olfr689'
ID38289
Institutional Source Beutler Lab
Gene Symbol Olfr689
Ensembl Gene ENSMUSG00000073907
Gene Nameolfactory receptor 689
SynonymsMOR40-3, GA_x6K02T2PBJ9-7942985-7943947
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0320 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105311165-105319662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105314654 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 217 (I217F)
Ref Sequence ENSEMBL: ENSMUSP00000151049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098153] [ENSMUST00000215413]
Predicted Effect probably benign
Transcript: ENSMUST00000098153
AA Change: I217F

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095756
Gene: ENSMUSG00000073907
AA Change: I217F

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 4.3e-74 PFAM
Pfam:7TM_GPCR_Srsx 40 311 3.9e-8 PFAM
Pfam:7tm_1 46 296 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215413
AA Change: I217F

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,614 T465A probably benign Het
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Aldh3b1 T C 19: 3,918,999 probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Cit C A 5: 115,979,445 L1227M possibly damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dopey2 C A 16: 93,810,147 R2113S probably benign Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Nrip1 T C 16: 76,292,363 T769A probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Parp4 T C 14: 56,588,496 probably null Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tigd4 T A 3: 84,595,174 V466E probably benign Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in Olfr689
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Olfr689 APN 7 105314232 missense probably damaging 0.99
R0533:Olfr689 UTSW 7 105314372 missense probably benign 0.05
R3499:Olfr689 UTSW 7 105314400 missense probably damaging 1.00
R5326:Olfr689 UTSW 7 105314439 missense probably damaging 1.00
R5424:Olfr689 UTSW 7 105314571 missense possibly damaging 0.96
R5595:Olfr689 UTSW 7 105314006 start codon destroyed probably benign
R5905:Olfr689 UTSW 7 105314951 missense probably benign
R6139:Olfr689 UTSW 7 105314246 missense probably damaging 0.99
R6230:Olfr689 UTSW 7 105314082 missense possibly damaging 0.59
R6259:Olfr689 UTSW 7 105314057 missense probably benign 0.01
R7471:Olfr689 UTSW 7 105314505 missense probably damaging 1.00
R7747:Olfr689 UTSW 7 105314447 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCATCCCAGTGCCTGTACTAGC -3'
(R):5'- TGAGTAGATGCCCCTGGAAGTTGTG -3'

Sequencing Primer
(F):5'- TGTACTAGCTGCCCAGAGAC -3'
(R):5'- GGTTTACTTCCTGGACACATAATGAC -3'
Posted On2013-05-23