Incidental Mutation 'R4939:Orc3'
ID382892
Institutional Source Beutler Lab
Gene Symbol Orc3
Ensembl Gene ENSMUSG00000040044
Gene Nameorigin recognition complex, subunit 3
SynonymsOrc3l
MMRRC Submission 042538-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4939 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location34570796-34614944 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 34593126 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 256 (Q256*)
Ref Sequence ENSEMBL: ENSMUSP00000119335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048706] [ENSMUST00000108142] [ENSMUST00000140334]
Predicted Effect probably null
Transcript: ENSMUST00000048706
AA Change: Q314*
SMART Domains Protein: ENSMUSP00000048319
Gene: ENSMUSG00000040044
AA Change: Q314*

DomainStartEndE-ValueType
Pfam:ORC3_N 25 350 3e-130 PFAM
low complexity region 653 664 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108142
AA Change: Q314*
SMART Domains Protein: ENSMUSP00000103777
Gene: ENSMUSG00000040044
AA Change: Q314*

DomainStartEndE-ValueType
Pfam:ORC3_N 24 350 7.7e-136 PFAM
low complexity region 652 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133107
Predicted Effect probably null
Transcript: ENSMUST00000140334
AA Change: Q256*
SMART Domains Protein: ENSMUSP00000119335
Gene: ENSMUSG00000040044
AA Change: Q256*

DomainStartEndE-ValueType
Pfam:ORC3_N 2 278 1.4e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156987
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Studies of a similar gene in Drosophila suggested a possible role of this protein in neuronal proliferation and olfactory memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the neural cells exhibit reduced neuronal precursor proliferation and reduced radial glial cell. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dnajc21 T A 15: 10,449,597 D446V probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Heatr5b T C 17: 78,762,260 E1686G probably benign Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Lepr A T 4: 101,733,438 K71I possibly damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Ncapd3 T C 9: 27,063,869 probably null Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Plxna4 T C 6: 32,165,762 Y1586C probably damaging Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Rrm1 T C 7: 102,466,924 V683A probably benign Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shank1 C T 7: 44,326,162 P477S unknown Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Orc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Orc3 APN 4 34595096 missense probably damaging 1.00
IGL03293:Orc3 APN 4 34595210 missense probably damaging 0.96
IGL02991:Orc3 UTSW 4 34593083 missense probably damaging 1.00
R0157:Orc3 UTSW 4 34607130 critical splice donor site probably null
R0708:Orc3 UTSW 4 34597368 missense probably damaging 1.00
R1331:Orc3 UTSW 4 34599748 missense probably benign 0.01
R1481:Orc3 UTSW 4 34607228 missense possibly damaging 0.50
R1755:Orc3 UTSW 4 34575114 missense possibly damaging 0.67
R1886:Orc3 UTSW 4 34584829 missense probably damaging 1.00
R2008:Orc3 UTSW 4 34611049 unclassified probably null
R2054:Orc3 UTSW 4 34584846 missense probably damaging 0.97
R2307:Orc3 UTSW 4 34586503 missense probably damaging 1.00
R3001:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3002:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3153:Orc3 UTSW 4 34575124 missense probably damaging 0.99
R4044:Orc3 UTSW 4 34587055 nonsense probably null
R4814:Orc3 UTSW 4 34572450 splice site probably benign
R4825:Orc3 UTSW 4 34571774 missense possibly damaging 0.95
R6314:Orc3 UTSW 4 34579797 missense possibly damaging 0.85
R6867:Orc3 UTSW 4 34605539 missense probably damaging 1.00
R7227:Orc3 UTSW 4 34572542 missense probably benign 0.00
R7417:Orc3 UTSW 4 34595136 missense probably damaging 1.00
R7655:Orc3 UTSW 4 34587032 nonsense probably null
R7656:Orc3 UTSW 4 34587032 nonsense probably null
R7707:Orc3 UTSW 4 34598691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCTTCTATAGGTGACTTCAGC -3'
(R):5'- GTTTAGCGGATGAGACCCTC -3'

Sequencing Primer
(F):5'- TGACTTCAGCATAATAAAGGAAAGG -3'
(R):5'- TCTCTCAAACAAACAGGCATTG -3'
Posted On2016-04-27