Incidental Mutation 'R4939:Lepr'
ID382894
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission 042538-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4939 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101733438 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 71 (K71I)
Ref Sequence ENSEMBL: ENSMUSP00000102534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921] [ENSMUST00000145024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037552
AA Change: K71I

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: K71I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102777
AA Change: K71I

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: K71I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106921
AA Change: K71I

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: K71I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145024
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dnajc21 T A 15: 10,449,597 D446V probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Heatr5b T C 17: 78,762,260 E1686G probably benign Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Ncapd3 T C 9: 27,063,869 probably null Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Orc3 G A 4: 34,593,126 Q256* probably null Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Plxna4 T C 6: 32,165,762 Y1586C probably damaging Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Rrm1 T C 7: 102,466,924 V683A probably benign Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shank1 C T 7: 44,326,162 P477S unknown Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATCTTCGTGACAATGATGGCTTG -3'
(R):5'- GGGCATAAAAGTACTTACCTAGCTG -3'

Sequencing Primer
(F):5'- CTGTCCTAGCAGAATTTCTTTATGTG -3'
(R):5'- GTACTTACCTAGCTGGCGAAAAACTG -3'
Posted On2016-04-27