Incidental Mutation 'R4939:Shank1'
ID382920
Institutional Source Beutler Lab
Gene Symbol Shank1
Ensembl Gene ENSMUSG00000038738
Gene NameSH3 and multiple ankyrin repeat domains 1
Synonyms
MMRRC Submission 042538-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R4939 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44310253-44360572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44326162 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 477 (P477S)
Ref Sequence ENSEMBL: ENSMUSP00000103571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107934] [ENSMUST00000107935] [ENSMUST00000107938]
Predicted Effect unknown
Transcript: ENSMUST00000107934
AA Change: P477S
SMART Domains Protein: ENSMUSP00000103567
Gene: ENSMUSG00000038738
AA Change: P477S

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
PDZ 663 752 2.12e-13 SMART
Blast:PDZ 795 830 5e-11 BLAST
low complexity region 920 941 N/A INTRINSIC
low complexity region 955 982 N/A INTRINSIC
low complexity region 993 1023 N/A INTRINSIC
low complexity region 1051 1080 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
low complexity region 1179 1220 N/A INTRINSIC
low complexity region 1256 1275 N/A INTRINSIC
low complexity region 1298 1323 N/A INTRINSIC
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1369 1404 N/A INTRINSIC
low complexity region 1450 1466 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
low complexity region 1539 1555 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
low complexity region 1580 1614 N/A INTRINSIC
low complexity region 1633 1667 N/A INTRINSIC
low complexity region 1685 1720 N/A INTRINSIC
low complexity region 1735 1746 N/A INTRINSIC
low complexity region 1776 1787 N/A INTRINSIC
low complexity region 1806 1823 N/A INTRINSIC
low complexity region 1834 1852 N/A INTRINSIC
low complexity region 1893 1907 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
low complexity region 1942 1976 N/A INTRINSIC
low complexity region 1988 2004 N/A INTRINSIC
low complexity region 2009 2029 N/A INTRINSIC
low complexity region 2059 2083 N/A INTRINSIC
SAM 2092 2158 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107935
AA Change: P477S
SMART Domains Protein: ENSMUSP00000103568
Gene: ENSMUSG00000038738
AA Change: P477S

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 796 831 1e-10 BLAST
low complexity region 921 942 N/A INTRINSIC
low complexity region 956 983 N/A INTRINSIC
low complexity region 994 1024 N/A INTRINSIC
low complexity region 1052 1081 N/A INTRINSIC
low complexity region 1124 1139 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
low complexity region 1180 1221 N/A INTRINSIC
low complexity region 1257 1276 N/A INTRINSIC
low complexity region 1299 1324 N/A INTRINSIC
low complexity region 1349 1360 N/A INTRINSIC
low complexity region 1370 1405 N/A INTRINSIC
low complexity region 1451 1467 N/A INTRINSIC
low complexity region 1513 1533 N/A INTRINSIC
low complexity region 1540 1556 N/A INTRINSIC
low complexity region 1558 1571 N/A INTRINSIC
low complexity region 1581 1615 N/A INTRINSIC
low complexity region 1634 1668 N/A INTRINSIC
low complexity region 1686 1721 N/A INTRINSIC
low complexity region 1736 1747 N/A INTRINSIC
low complexity region 1777 1788 N/A INTRINSIC
low complexity region 1807 1824 N/A INTRINSIC
low complexity region 1835 1853 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 1926 1937 N/A INTRINSIC
low complexity region 1943 1977 N/A INTRINSIC
low complexity region 1989 2005 N/A INTRINSIC
low complexity region 2010 2030 N/A INTRINSIC
low complexity region 2060 2084 N/A INTRINSIC
SAM 2093 2159 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107938
AA Change: P477S
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738
AA Change: P477S

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SHANK (SH3 domain and ankyrin repeat containing) family of proteins. Members of this family act as scaffold proteins that are required for the development and function of neuronal synapses. Deletions in this gene may be associated with autism spectrum disorder in males. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutation of this gene results in smaller pyramidal neuron dendritic spines, smaller and thinner postsynaptic density of central excitatory synapses, weaker synaptic transmission, increased anxiety-related behavior, and impaired contextual fearmemory, but enhanced spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dnajc21 T A 15: 10,449,597 D446V probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Heatr5b T C 17: 78,762,260 E1686G probably benign Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Lepr A T 4: 101,733,438 K71I possibly damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Ncapd3 T C 9: 27,063,869 probably null Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Orc3 G A 4: 34,593,126 Q256* probably null Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Plxna4 T C 6: 32,165,762 Y1586C probably damaging Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Rrm1 T C 7: 102,466,924 V683A probably benign Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Shank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Shank1 APN 7 44354238 missense possibly damaging 0.89
IGL01293:Shank1 APN 7 44354236 missense possibly damaging 0.59
IGL01319:Shank1 APN 7 44353123 missense possibly damaging 0.93
IGL01347:Shank1 APN 7 44342120 missense unknown
IGL01621:Shank1 APN 7 44342465 missense unknown
IGL01621:Shank1 APN 7 44351599 missense unknown
IGL01964:Shank1 APN 7 44325678 missense unknown
IGL02309:Shank1 APN 7 44312842 missense unknown
IGL02325:Shank1 APN 7 44327080 nonsense probably null
IGL02387:Shank1 APN 7 44356937 missense possibly damaging 0.77
IGL02958:Shank1 APN 7 44354473 missense possibly damaging 0.59
R0098:Shank1 UTSW 7 44313285 missense unknown
R0098:Shank1 UTSW 7 44313285 missense unknown
R0197:Shank1 UTSW 7 44352294 missense unknown
R0326:Shank1 UTSW 7 44319170 missense unknown
R0365:Shank1 UTSW 7 44353977 missense possibly damaging 0.89
R0883:Shank1 UTSW 7 44352294 missense unknown
R1033:Shank1 UTSW 7 44356796 missense possibly damaging 0.77
R1390:Shank1 UTSW 7 44357038 missense probably damaging 1.00
R1453:Shank1 UTSW 7 44316075 missense unknown
R1594:Shank1 UTSW 7 44327223 nonsense probably null
R1713:Shank1 UTSW 7 44319737 missense unknown
R1783:Shank1 UTSW 7 44352737 missense possibly damaging 0.70
R1869:Shank1 UTSW 7 44342115 nonsense probably null
R1870:Shank1 UTSW 7 44342115 nonsense probably null
R1959:Shank1 UTSW 7 44325377 missense unknown
R1962:Shank1 UTSW 7 44344323 critical splice donor site probably null
R2406:Shank1 UTSW 7 44356952 missense possibly damaging 0.94
R2509:Shank1 UTSW 7 44351724 missense unknown
R2509:Shank1 UTSW 7 44352123 missense unknown
R3877:Shank1 UTSW 7 44344992 missense unknown
R4041:Shank1 UTSW 7 44342162 missense unknown
R4249:Shank1 UTSW 7 44319736 missense unknown
R4303:Shank1 UTSW 7 44342474 missense unknown
R4431:Shank1 UTSW 7 44319652 nonsense probably null
R4525:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4527:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4642:Shank1 UTSW 7 44313141 missense unknown
R4722:Shank1 UTSW 7 44313214 nonsense probably null
R4805:Shank1 UTSW 7 44343711 missense unknown
R4874:Shank1 UTSW 7 44316073 missense unknown
R4904:Shank1 UTSW 7 44334040 intron probably benign
R5394:Shank1 UTSW 7 44352651 missense possibly damaging 0.85
R5410:Shank1 UTSW 7 44351822 missense unknown
R5556:Shank1 UTSW 7 44344315 intron probably benign
R5620:Shank1 UTSW 7 44312736 missense unknown
R5656:Shank1 UTSW 7 44352886 missense probably benign 0.33
R5688:Shank1 UTSW 7 44354487 missense possibly damaging 0.77
R5740:Shank1 UTSW 7 44353740 missense possibly damaging 0.89
R5801:Shank1 UTSW 7 44356816 missense possibly damaging 0.77
R6179:Shank1 UTSW 7 44357206 missense possibly damaging 0.58
R6186:Shank1 UTSW 7 44352566 missense probably benign 0.18
R6245:Shank1 UTSW 7 44352253 missense unknown
R6500:Shank1 UTSW 7 44327221 missense unknown
R6602:Shank1 UTSW 7 44352336 missense probably benign 0.03
R6655:Shank1 UTSW 7 44327220 missense unknown
R6709:Shank1 UTSW 7 44354176 missense probably benign 0.43
R6734:Shank1 UTSW 7 44353686 missense probably benign 0.01
R6881:Shank1 UTSW 7 44351793 missense unknown
R6902:Shank1 UTSW 7 44356815 missense probably benign 0.39
R6975:Shank1 UTSW 7 44313106 splice site probably null
R6985:Shank1 UTSW 7 44344913 missense unknown
R7072:Shank1 UTSW 7 44344946 missense unknown
R7116:Shank1 UTSW 7 44327161 missense unknown
R7117:Shank1 UTSW 7 44327161 missense unknown
R7199:Shank1 UTSW 7 44353140 missense possibly damaging 0.86
R7249:Shank1 UTSW 7 44327161 missense unknown
R7252:Shank1 UTSW 7 44327161 missense unknown
R7552:Shank1 UTSW 7 44353028 missense probably benign 0.00
R7653:Shank1 UTSW 7 44319669 missense unknown
R7707:Shank1 UTSW 7 44344301 missense unknown
R7801:Shank1 UTSW 7 44351598 missense unknown
R7804:Shank1 UTSW 7 44312884 missense unknown
X0019:Shank1 UTSW 7 44356928 missense probably damaging 1.00
X0065:Shank1 UTSW 7 44351929 missense unknown
Z1088:Shank1 UTSW 7 44352166 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCAGTACCTTTCCAGGAGTCC -3'
(R):5'- GCTGCAGGTAGGTATGGAAC -3'

Sequencing Primer
(F):5'- TTCCAGGAGTCCCCCAAGTATG -3'
(R):5'- GGTATGGAACCCACCACTCCTG -3'
Posted On2016-04-27