Incidental Mutation 'R4939:Rrm1'
ID 382924
Institutional Source Beutler Lab
Gene Symbol Rrm1
Ensembl Gene ENSMUSG00000030978
Gene Name ribonucleotide reductase M1
Synonyms RnrM1
MMRRC Submission 042538-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R4939 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102441695-102469771 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102466924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 683 (V683A)
Ref Sequence ENSEMBL: ENSMUSP00000033283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000209630]
AlphaFold P07742
Predicted Effect probably benign
Transcript: ENSMUST00000033283
AA Change: V683A

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: V683A

DomainStartEndE-ValueType
Pfam:ATP-cone 1 89 8.7e-21 PFAM
Pfam:Ribonuc_red_lgN 141 213 2.8e-25 PFAM
Pfam:Ribonuc_red_lgC 216 738 1.6e-197 PFAM
coiled coil region 749 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210543
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dnajc21 T A 15: 10,449,597 D446V probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Heatr5b T C 17: 78,762,260 E1686G probably benign Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Lepr A T 4: 101,733,438 K71I possibly damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Ncapd3 T C 9: 27,063,869 probably null Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Orc3 G A 4: 34,593,126 Q256* probably null Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Plxna4 T C 6: 32,165,762 Y1586C probably damaging Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shank1 C T 7: 44,326,162 P477S unknown Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Rrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rrm1 APN 7 102454507 nonsense probably null
IGL01431:Rrm1 APN 7 102457552 splice site probably benign
IGL03251:Rrm1 APN 7 102457206 missense probably damaging 1.00
IGL03401:Rrm1 APN 7 102465744 missense possibly damaging 0.81
Arabica UTSW 7 102460351 missense probably damaging 1.00
Pentose UTSW 7 102460856 splice site probably null
R0454:Rrm1 UTSW 7 102466926 missense probably damaging 1.00
R0548:Rrm1 UTSW 7 102467067 critical splice donor site probably null
R0759:Rrm1 UTSW 7 102457561 missense probably benign 0.32
R1575:Rrm1 UTSW 7 102456514 missense probably damaging 1.00
R1586:Rrm1 UTSW 7 102466905 makesense probably null
R1625:Rrm1 UTSW 7 102468347 missense probably damaging 0.98
R2207:Rrm1 UTSW 7 102442026 start codon destroyed probably null 0.98
R2432:Rrm1 UTSW 7 102443072 missense probably benign 0.03
R2513:Rrm1 UTSW 7 102460689 missense probably damaging 0.99
R3796:Rrm1 UTSW 7 102465703 splice site probably null
R3914:Rrm1 UTSW 7 102457174 missense probably damaging 1.00
R4179:Rrm1 UTSW 7 102457198 missense probably damaging 1.00
R4302:Rrm1 UTSW 7 102447824 missense probably benign 0.00
R4379:Rrm1 UTSW 7 102446593 missense probably damaging 1.00
R4416:Rrm1 UTSW 7 102447801 missense probably benign 0.06
R4690:Rrm1 UTSW 7 102447879 missense probably benign
R5433:Rrm1 UTSW 7 102465767 missense probably damaging 0.97
R5445:Rrm1 UTSW 7 102451023 missense possibly damaging 0.77
R6120:Rrm1 UTSW 7 102460856 splice site probably null
R6198:Rrm1 UTSW 7 102446729 critical splice donor site probably null
R6369:Rrm1 UTSW 7 102446702 missense probably damaging 0.97
R6699:Rrm1 UTSW 7 102460825 missense probably damaging 1.00
R7009:Rrm1 UTSW 7 102460334 missense probably damaging 1.00
R7491:Rrm1 UTSW 7 102454557 missense probably damaging 1.00
R8024:Rrm1 UTSW 7 102457265 missense probably benign 0.00
R8276:Rrm1 UTSW 7 102460852 critical splice donor site probably null
R8713:Rrm1 UTSW 7 102460351 missense probably damaging 1.00
R8963:Rrm1 UTSW 7 102456532 missense probably benign 0.23
R8968:Rrm1 UTSW 7 102468338 missense probably benign 0.03
R9028:Rrm1 UTSW 7 102460398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTTGGGCTAACTTGCTATAAGC -3'
(R):5'- TTCGAGCTGGCAATTAAGTCCTC -3'

Sequencing Primer
(F):5'- CTAACTCATAGCGGTATCAGGTCTG -3'
(R):5'- GGCAATTAAGTCCTCCTCAGAGTG -3'
Posted On 2016-04-27