Incidental Mutation 'R4939:Ncapd3'
ID382929
Institutional Source Beutler Lab
Gene Symbol Ncapd3
Ensembl Gene ENSMUSG00000035024
Gene Namenon-SMC condensin II complex, subunit D3
Synonyms4632407J06Rik, B130055D15Rik, 2810487N22Rik
MMRRC Submission 042538-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4939 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location27030175-27095315 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 27063869 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
Predicted Effect probably null
Transcript: ENSMUST00000073127
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000073127
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086198
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000216677
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dnajc21 T A 15: 10,449,597 D446V probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Heatr5b T C 17: 78,762,260 E1686G probably benign Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Lepr A T 4: 101,733,438 K71I possibly damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Orc3 G A 4: 34,593,126 Q256* probably null Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Plxna4 T C 6: 32,165,762 Y1586C probably damaging Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Rrm1 T C 7: 102,466,924 V683A probably benign Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shank1 C T 7: 44,326,162 P477S unknown Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Ncapd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Ncapd3 APN 9 27052353 missense probably benign
IGL00544:Ncapd3 APN 9 27063338 missense possibly damaging 0.94
IGL01657:Ncapd3 APN 9 27071824 missense possibly damaging 0.81
IGL01979:Ncapd3 APN 9 27071965 critical splice donor site probably null
IGL02073:Ncapd3 APN 9 27063316 missense probably benign 0.03
IGL02083:Ncapd3 APN 9 27051821 missense probably damaging 1.00
IGL02383:Ncapd3 APN 9 27050328 missense probably benign 0.44
IGL02429:Ncapd3 APN 9 27089302 missense probably benign 0.08
IGL02437:Ncapd3 APN 9 27063968 splice site probably benign
IGL02861:Ncapd3 APN 9 27069899 missense probably benign 0.00
IGL03202:Ncapd3 APN 9 27071715 splice site probably benign
IGL03219:Ncapd3 APN 9 27063873 splice site probably benign
IGL03252:Ncapd3 APN 9 27051449 missense probably damaging 1.00
pevensie UTSW 9 27086046 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0084:Ncapd3 UTSW 9 27056111 missense probably damaging 0.98
R0491:Ncapd3 UTSW 9 27057883 missense probably damaging 0.97
R0513:Ncapd3 UTSW 9 27064105 splice site probably benign
R0565:Ncapd3 UTSW 9 27087998 missense probably benign 0.00
R0601:Ncapd3 UTSW 9 27041507 missense probably benign 0.05
R0671:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0673:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0842:Ncapd3 UTSW 9 27037084 missense probably benign 0.01
R1178:Ncapd3 UTSW 9 27041421 missense probably benign
R1366:Ncapd3 UTSW 9 27057940 missense probably damaging 1.00
R1432:Ncapd3 UTSW 9 27069872 splice site probably benign
R1439:Ncapd3 UTSW 9 27087566 critical splice donor site probably null
R1532:Ncapd3 UTSW 9 27083360 nonsense probably null
R2131:Ncapd3 UTSW 9 27083346 missense probably damaging 0.98
R2178:Ncapd3 UTSW 9 27088549 missense probably benign 0.01
R2238:Ncapd3 UTSW 9 27067024 missense probably benign
R2258:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2259:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2260:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2297:Ncapd3 UTSW 9 27041501 nonsense probably null
R2877:Ncapd3 UTSW 9 27044487 splice site probably null
R3612:Ncapd3 UTSW 9 27050357 missense probably damaging 1.00
R3709:Ncapd3 UTSW 9 27052349 missense probably benign 0.00
R3791:Ncapd3 UTSW 9 27052635 missense probably benign 0.27
R4052:Ncapd3 UTSW 9 27089383 splice site probably null
R4297:Ncapd3 UTSW 9 27052327 missense probably benign
R4299:Ncapd3 UTSW 9 27052327 missense probably benign
R4441:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R4572:Ncapd3 UTSW 9 27094615 missense probably damaging 1.00
R4675:Ncapd3 UTSW 9 27094742 unclassified probably benign
R4790:Ncapd3 UTSW 9 27051850 missense probably benign 0.00
R4835:Ncapd3 UTSW 9 27086046 missense probably damaging 1.00
R4919:Ncapd3 UTSW 9 27051775 missense possibly damaging 0.95
R4928:Ncapd3 UTSW 9 27071735 nonsense probably null
R4980:Ncapd3 UTSW 9 27063295 missense probably damaging 0.99
R5030:Ncapd3 UTSW 9 27071766 missense probably damaging 0.98
R5052:Ncapd3 UTSW 9 27051719 missense probably damaging 1.00
R5180:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5343:Ncapd3 UTSW 9 27088053 small deletion probably benign
R5656:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5840:Ncapd3 UTSW 9 27094758 missense probably benign 0.00
R5900:Ncapd3 UTSW 9 27066969 missense probably benign 0.26
R6093:Ncapd3 UTSW 9 27056158 missense probably damaging 0.99
R6122:Ncapd3 UTSW 9 27063982 missense probably benign 0.00
R6249:Ncapd3 UTSW 9 27088053 small deletion probably benign
R6428:Ncapd3 UTSW 9 27052664 splice site probably null
R6432:Ncapd3 UTSW 9 27044509 missense probably damaging 0.98
R6441:Ncapd3 UTSW 9 27063416 missense probably benign 0.03
R6459:Ncapd3 UTSW 9 27051755 missense probably benign 0.00
R6567:Ncapd3 UTSW 9 27067004 missense possibly damaging 0.83
R6722:Ncapd3 UTSW 9 27087556 missense probably benign
R6862:Ncapd3 UTSW 9 27030809 missense probably damaging 0.98
R7234:Ncapd3 UTSW 9 27050359 missense probably damaging 0.97
R7286:Ncapd3 UTSW 9 27069958 missense probably damaging 1.00
R7404:Ncapd3 UTSW 9 27067019 missense probably benign 0.01
R7541:Ncapd3 UTSW 9 27067040 missense probably damaging 0.99
R7583:Ncapd3 UTSW 9 27071848 missense probably damaging 1.00
R7655:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7656:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7815:Ncapd3 UTSW 9 27063440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAGACCTCACAGTTAAGCCATG -3'
(R):5'- AGACGAACTGATCAGCTCTG -3'

Sequencing Primer
(F):5'- GACCTCACAGTTAAGCCATGTTAAC -3'
(R):5'- GAACTGATCAGCTCTGGAGACC -3'
Posted On2016-04-27