Incidental Mutation 'R4939:Dnajc21'
ID382951
Institutional Source Beutler Lab
Gene Symbol Dnajc21
Ensembl Gene ENSMUSG00000044224
Gene NameDnaJ heat shock protein family (Hsp40) member C21
Synonyms9930116P15Rik, 4930461P20Rik
MMRRC Submission 042538-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R4939 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10446756-10470516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10449597 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 446 (D446V)
Ref Sequence ENSEMBL: ENSMUSP00000116865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136591]
Predicted Effect probably damaging
Transcript: ENSMUST00000136591
AA Change: D446V

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116865
Gene: ENSMUSG00000044224
AA Change: D446V

DomainStartEndE-ValueType
DnaJ 2 61 7.2e-29 SMART
coiled coil region 178 283 N/A INTRINSIC
ZnF_U1 311 345 5.3e-8 SMART
ZnF_C2H2 314 338 1.67e-2 SMART
low complexity region 379 393 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
ZnF_C2H2 483 507 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145719
SMART Domains Protein: ENSMUSP00000116192
Gene: ENSMUSG00000044224

DomainStartEndE-ValueType
coiled coil region 26 131 N/A INTRINSIC
ZnF_U1 160 194 5.3e-8 SMART
ZnF_C2H2 163 187 1.67e-2 SMART
low complexity region 228 242 N/A INTRINSIC
low complexity region 301 319 N/A INTRINSIC
ZnF_C2H2 332 356 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150878
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the precursor 45S ribosomal RNA and may be involved in early nuclear ribosomal RNA biogenesis and maturation of the 60S ribosomal subunit. Mutations in this gene result in Bone marrow failure syndrome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,243,725 Y365F possibly damaging Het
Atp2a1 T C 7: 126,450,116 M585V probably benign Het
Brca1 A G 11: 101,508,050 V1572A probably benign Het
C1ql4 A T 15: 99,087,640 M30K probably damaging Het
Ccdc73 A G 2: 104,992,157 probably null Het
Cdk6 A T 5: 3,344,377 D4V probably null Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Clic4 T C 4: 135,223,541 E113G probably benign Het
Creld1 C A 6: 113,488,179 H122Q probably benign Het
Cyp4a29 G A 4: 115,247,676 probably null Het
Dnaaf3 A T 7: 4,527,145 S246R probably damaging Het
Dnah12 A T 14: 26,891,524 T3925S probably damaging Het
Dock8 A T 19: 25,122,400 Y629F probably damaging Het
E2f8 A T 7: 48,872,138 N405K probably benign Het
Flg A G 3: 93,279,847 N202S probably benign Het
Glyatl3 A G 17: 40,910,023 probably null Het
Gm10696 A T 3: 94,176,233 Y90* probably null Het
Gm38999 A G 7: 43,428,461 T63A possibly damaging Het
Gm4981 T C 10: 58,235,603 N263S probably benign Het
Grap A G 11: 61,660,298 Y52C probably damaging Het
Haus2 T A 2: 120,619,036 I187K probably damaging Het
Heatr5b T C 17: 78,762,260 E1686G probably benign Het
Herc2 A G 7: 56,206,736 D3944G probably damaging Het
Hexdc A T 11: 121,207,716 M9L probably benign Het
Hoxa3 T C 6: 52,170,676 probably benign Het
Hspg2 A T 4: 137,508,031 I126F probably damaging Het
Itpr1 T A 6: 108,440,558 C123* probably null Het
Jmjd1c T A 10: 67,246,137 N2346K possibly damaging Het
Kctd9 A G 14: 67,729,686 Y37C probably damaging Het
Kmt5b A C 19: 3,815,245 S747R possibly damaging Het
Krt26 T C 11: 99,334,696 M320V probably benign Het
Lama1 T G 17: 67,737,475 V123G possibly damaging Het
Lamc2 T C 1: 153,126,836 D1103G probably damaging Het
Lepr A T 4: 101,733,438 K71I possibly damaging Het
Llgl1 A T 11: 60,709,979 probably null Het
Mcoln2 A T 3: 146,192,241 H39L probably benign Het
Myh11 T A 16: 14,239,507 T315S probably benign Het
Ncapd3 T C 9: 27,063,869 probably null Het
Nlrp9b G T 7: 20,024,496 V553F probably damaging Het
Nubpl A G 12: 52,181,095 N129S probably damaging Het
Nup214 C A 2: 31,983,159 T255K probably benign Het
Olfr1390 A G 11: 49,340,549 T6A probably benign Het
Olfr1469 T A 19: 13,410,855 N95K probably benign Het
Olfr218 T C 1: 173,203,463 Y36H possibly damaging Het
Olfr325 G T 11: 58,581,211 M122I probably damaging Het
Olfr464 G T 11: 87,914,124 P261T probably damaging Het
Olfr619 T C 7: 103,604,251 V199A probably benign Het
Orc3 G A 4: 34,593,126 Q256* probably null Het
Pbrm1 A G 14: 31,061,623 M566V probably damaging Het
Pde6b A G 5: 108,421,497 I357V probably benign Het
Pkdrej A G 15: 85,820,283 I484T possibly damaging Het
Plvap A G 8: 71,511,439 V93A probably benign Het
Plxna4 T C 6: 32,165,762 Y1586C probably damaging Het
Ppfia4 A T 1: 134,328,079 L196Q possibly damaging Het
Ptpn13 T G 5: 103,517,469 probably null Het
Ranbp17 T C 11: 33,219,223 N997S probably benign Het
Rpap2 G T 5: 107,603,625 probably null Het
Rrm1 T C 7: 102,466,924 V683A probably benign Het
Ruvbl1 A G 6: 88,483,039 probably null Het
Sh3pxd2a A G 19: 47,278,404 Y277H probably damaging Het
Shank1 C T 7: 44,326,162 P477S unknown Het
Shtn1 T C 19: 59,022,201 E278G probably benign Het
Skap2 T A 6: 51,922,323 I109F possibly damaging Het
Skiv2l2 T C 13: 112,909,892 D308G possibly damaging Het
Slc28a3 A C 13: 58,558,581 I615M probably benign Het
Slc4a11 A G 2: 130,684,868 L780P probably damaging Het
Slc5a4b T C 10: 76,081,467 E245G probably benign Het
Slfn8 C T 11: 83,003,285 A843T probably benign Het
Sncaip A T 18: 52,907,263 Q843L possibly damaging Het
Spidr T A 16: 16,140,746 K51* probably null Het
Tas2r123 T C 6: 132,847,845 V235A probably benign Het
Tgfbr3 T C 5: 107,130,469 D757G probably benign Het
Tmem132d A T 5: 127,796,075 V490D probably damaging Het
Top2a T A 11: 99,010,092 H557L probably damaging Het
Trafd1 A G 5: 121,375,191 I328T probably benign Het
Trappc11 G A 8: 47,519,665 A291V probably damaging Het
Tuba1c A G 15: 99,037,954 Y432C probably damaging Het
Utp11 T G 4: 124,683,250 R109S possibly damaging Het
Vmn1r159 T G 7: 22,842,891 T239P probably damaging Het
Vwce A T 19: 10,645,050 N239Y probably damaging Het
Yes1 T C 5: 32,645,113 probably null Het
Zfand6 A C 7: 84,615,822 *224G probably null Het
Zfp408 A T 2: 91,645,105 I668N probably damaging Het
Zfp647 TGCACG TGCACGCACG 15: 76,911,044 probably null Het
Zfp946 T C 17: 22,455,437 F391L probably damaging Het
Other mutations in Dnajc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Dnajc21 APN 15 10447102 missense probably benign 0.01
IGL02797:Dnajc21 APN 15 10461355 missense probably damaging 0.96
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R1480:Dnajc21 UTSW 15 10459951 splice site probably null
R1694:Dnajc21 UTSW 15 10451563 missense probably benign 0.00
R1777:Dnajc21 UTSW 15 10449607 missense probably benign 0.00
R2420:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2421:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2422:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R4065:Dnajc21 UTSW 15 10451553 critical splice donor site probably null
R4182:Dnajc21 UTSW 15 10459933 splice site probably null
R4546:Dnajc21 UTSW 15 10447097 missense probably benign 0.01
R4644:Dnajc21 UTSW 15 10463917 missense possibly damaging 0.89
R5075:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R5187:Dnajc21 UTSW 15 10463964 missense probably benign 0.21
R5273:Dnajc21 UTSW 15 10454807 missense probably damaging 1.00
R5590:Dnajc21 UTSW 15 10462277 missense possibly damaging 0.92
R5643:Dnajc21 UTSW 15 10461915 missense probably benign
R5644:Dnajc21 UTSW 15 10461915 missense probably benign
R5729:Dnajc21 UTSW 15 10449596 missense probably benign 0.01
R6614:Dnajc21 UTSW 15 10470263 critical splice donor site probably null
R6815:Dnajc21 UTSW 15 10447691 splice site probably null
R7016:Dnajc21 UTSW 15 10461407 nonsense probably null
R7076:Dnajc21 UTSW 15 10449631 missense probably benign
R7584:Dnajc21 UTSW 15 10462295 nonsense probably null
R7624:Dnajc21 UTSW 15 10461232 missense probably benign 0.07
R7624:Dnajc21 UTSW 15 10461234 missense probably damaging 0.98
R7676:Dnajc21 UTSW 15 10462344 missense possibly damaging 0.95
R7788:Dnajc21 UTSW 15 10460047 missense probably damaging 1.00
R7845:Dnajc21 UTSW 15 10447141 missense probably damaging 1.00
R8552:Dnajc21 UTSW 15 10463919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACAATGTCACCTCACATCT -3'
(R):5'- TCTCATTCCACATATTGACTTACCA -3'

Sequencing Primer
(F):5'- CATCTGTGTGTGATTGTGTGGCTAC -3'
(R):5'- GAGGAAAGATTGCTCCAGAA -3'
Posted On2016-04-27