Mutagenetix > Incidental Mutation

Incidental Mutation 'R4940:Pon3'

382994

Institutional Source

Beutler Lab

Gene Symbol

Pon3

Ensembl Gene

ENSMUSG00000029759

Gene Name

paraoxonase 3

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4940 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5220852-5256286 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5221625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 335 (V335E)

Ref Sequence

ENSEMBL: ENSMUSP00000031773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031773] [ENSMUST00000129344]

AlphaFold

Q62087

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031773
AA Change: V335E

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031773
Gene: ENSMUSG00000029759
AA Change: V335E

Domain	Start	End	E-Value	Type
Pfam:SGL	84	304	8.8e-9	PFAM
Pfam:Arylesterase	167	252	2.5e-43	PFAM
Pfam:Str_synth	184	250	3e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129344

SMART Domains

Protein: ENSMUSP00000118137
Gene: ENSMUSG00000029759

Domain	Start	End	E-Value	Type
PDB:4HHQ\|A	1	67	3e-17	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203092

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show prenatal and postnatal lethality. Homozygotes for a different null allele are viable but show altered lipid and bile acid metabolism, impaired mitochondrial respiration, and increased susceptibility to diet-induced atherosclerosis, gallstone formation, and obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	G	5: 98,737,636	H134R	possibly damaging	Het
3632451O06Rik	A	T	14: 49,773,482	M256K	probably benign	Het
4931414P19Rik	T	C	14: 54,591,325	T240A	probably benign	Het
Abca15	T	C	7: 120,332,694	Y57H	probably benign	Het
Adgrf4	A	G	17: 42,666,529	I641T	possibly damaging	Het
Ankrd11	A	G	8: 122,889,821	Y2410H	probably damaging	Het
Apbb2	C	A	5: 66,452,261	L14F	probably null	Het
Arhgdia	T	C	11: 120,579,235	D204G	probably damaging	Het
Catsperd	A	T	17: 56,662,736	Y610F	possibly damaging	Het
Cblb	T	A	16: 52,033,103	D27E	probably damaging	Het
Ccdc180	A	T	4: 45,917,453	I893F	probably damaging	Het
Ccdc180	A	G	4: 45,917,508	H911R	probably damaging	Het
Cdh23	T	A	10: 60,307,935	I2966F	probably damaging	Het
Chat	G	A	14: 32,419,105	P445L	probably damaging	Het
Chdh	G	T	14: 30,032,852	R273L	possibly damaging	Het
Clic3	T	C	2: 25,457,917	V72A	probably benign	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Ddr1	T	A	17: 35,690,130	D241V	probably damaging	Het
Dock7	T	A	4: 99,020,077	K605N	probably damaging	Het
Dsg2	T	A	18: 20,579,430	F164I	probably damaging	Het
Dstyk	T	A	1: 132,453,106	N446K	probably damaging	Het
Epb42	A	T	2: 121,034,451	L53Q	probably damaging	Het
Extl2	G	C	3: 116,027,192	K229N	probably benign	Het
Frmd4b	T	A	6: 97,298,090	S617C	probably damaging	Het
Fscb	C	T	12: 64,473,814	V293I	probably benign	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm4978	A	C	9: 69,450,872		probably benign	Het
Gm6729	A	G	10: 86,540,388		noncoding transcript	Het
Gnat2	A	C	3: 108,100,616	N293T	probably benign	Het
Herpud1	T	C	8: 94,390,842	I142T	probably benign	Het
Irak2	G	A	6: 113,693,730	V536I	probably benign	Het
Kcnu1	A	T	8: 25,897,862		probably null	Het
Kdm4a	A	G	4: 118,161,754	S422P	probably benign	Het
Lair1	T	A	7: 4,028,949	D53V	probably benign	Het
Lhx1	G	T	11: 84,519,909	Y196*	probably null	Het
Lrrc37a	G	A	11: 103,497,612	T2329I	unknown	Het
Mag	T	C	7: 30,909,200	D163G	probably damaging	Het
Magi3	A	G	3: 104,051,392	V459A	probably damaging	Het
Med13	A	G	11: 86,288,118	Y1451H	probably damaging	Het
Megf8	T	A	7: 25,360,706	C2341S	probably damaging	Het
Mppe1	A	G	18: 67,228,024	C221R	probably damaging	Het
Mtus1	T	A	8: 41,041,478	H39L	possibly damaging	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nutm2	T	C	13: 50,474,873	C658R	possibly damaging	Het
Olfm1	T	C	2: 28,222,590	V239A	possibly damaging	Het
Pcnx	C	T	12: 81,917,793	H245Y	possibly damaging	Het
Pgm3	A	G	9: 86,559,476	L356S	probably damaging	Het
Pik3r4	C	G	9: 105,668,994	H207D	probably benign	Het
Pkd1l1	T	C	11: 8,844,585	T1859A	probably benign	Het
Ppp4r3b	A	G	11: 29,211,740	T705A	probably benign	Het
Prmt7	T	C	8: 106,237,278	V268A	probably benign	Het
Psd	C	T	19: 46,322,417	G398R	probably damaging	Het
Pygl	A	G	12: 70,206,381	V188A	probably damaging	Het
Rnf13	T	A	3: 57,796,206	N110K	probably damaging	Het
Rnf170	C	T	8: 26,125,911	Q77*	probably null	Het
Rrp8	A	T	7: 105,734,077	Y327*	probably null	Het
Ruvbl2	T	C	7: 45,424,726	D228G	probably damaging	Het
Scgn	T	A	13: 23,989,824	T35S	probably benign	Het
Scyl3	C	T	1: 163,934,747	P74S	probably damaging	Het
Sec61b	T	G	4: 47,483,074	S123A	probably benign	Het
Sertad2	T	C	11: 20,647,899	S32P	possibly damaging	Het
Slc23a3	T	C	1: 75,133,803		probably null	Het
Sult2a2	T	G	7: 13,738,298	V140G	probably benign	Het
Tbc1d4	A	T	14: 101,507,231	S320T	probably benign	Het
Trabd2b	T	C	4: 114,408,944	Y52H	probably damaging	Het
Traf2	T	C	2: 25,530,288	E183G	probably null	Het
Trip10	G	T	17: 57,263,017	V561F	possibly damaging	Het
Ttc7	G	T	17: 87,306,958	V184F	probably benign	Het
Ubc	A	G	5: 125,386,229	V678A	probably benign	Het
Unk	A	G	11: 116,053,665	E414G	possibly damaging	Het
Usp42	T	C	5: 143,719,762	N365D	probably damaging	Het
Zbtb26	A	T	2: 37,436,769	I85K	probably damaging	Het
Zfhx2	A	T	14: 55,066,434	H1364Q	possibly damaging	Het

Other mutations in Pon3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01977:Pon3	APN	6	5221670	missense	probably damaging	1.00
IGL01983:Pon3	APN	6	5240974	missense	probably damaging	1.00
IGL02601:Pon3	APN	6	5221671	missense	probably damaging	1.00
IGL02661:Pon3	APN	6	5256205	missense	probably benign	0.05
IGL03168:Pon3	APN	6	5256177	missense	possibly damaging	0.54
IGL02988:Pon3	UTSW	6	5232330	missense	possibly damaging	0.91
R0242:Pon3	UTSW	6	5240860	missense	probably benign	0.25
R0242:Pon3	UTSW	6	5240860	missense	probably benign	0.25
R0566:Pon3	UTSW	6	5232408	missense	possibly damaging	0.89
R0730:Pon3	UTSW	6	5230444	missense	probably benign	0.18
R1378:Pon3	UTSW	6	5230813	missense	probably benign	0.08
R1955:Pon3	UTSW	6	5230774	missense	probably benign	0.02
R2697:Pon3	UTSW	6	5232429	missense	possibly damaging	0.67
R2975:Pon3	UTSW	6	5232345	missense	probably damaging	1.00
R3794:Pon3	UTSW	6	5221578	missense	probably benign	0.22
R4988:Pon3	UTSW	6	5254582	nonsense	probably null
R4990:Pon3	UTSW	6	5221619	missense	probably benign
R5266:Pon3	UTSW	6	5240860	missense	possibly damaging	0.66
R5473:Pon3	UTSW	6	5256177	missense	possibly damaging	0.54
R6152:Pon3	UTSW	6	5221716	missense	probably damaging	1.00
R6746:Pon3	UTSW	6	5230786	missense	possibly damaging	0.54
R7140:Pon3	UTSW	6	5221664	missense	possibly damaging	0.92
R7450:Pon3	UTSW	6	5236940	missense	possibly damaging	0.80
R7853:Pon3	UTSW	6	5236911	missense	probably damaging	1.00
R8481:Pon3	UTSW	6	5221715	missense	probably benign	0.23
R9200:Pon3	UTSW	6	5240863	missense	probably benign	0.42
R9344:Pon3	UTSW	6	5221586	missense	probably benign	0.03
R9736:Pon3	UTSW	6	5232339	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCTGGTTGCCACTCACTAACTTG -3'
(R):5'- TCCCAGAATCGGTGGAAAGG -3'

Sequencing Primer
(F):5'- GCCACTCACTAACTTGATTCTTG -3'
(R):5'- TGGAAAGGGAAATAGCTCTGTATAGC -3'

Posted On

2016-04-27