Mutagenetix > Incidental Mutation

Incidental Mutation 'R4940:Lair1'

382997

Institutional Source

Beutler Lab

Gene Symbol

Lair1

Ensembl Gene

ENSMUSG00000055541

Gene Name

leukocyte-associated Ig-like receptor 1

Synonyms

mLair-1, Lair-1, 5133400O11Rik, D7Bwg0421e

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4940 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4003402-4063204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4028949 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 53 (D53V)

Ref Sequence

ENSEMBL: ENSMUSP00000104241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]

AlphaFold

Q8BG84

Predicted Effect

probably benign
Transcript: ENSMUST00000068865

SMART Domains

Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	33	55	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086400
AA Change: D53V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541
AA Change: D53V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	134	5e-79	PDB
SCOP:d1nkr_2	24	118	2e-9	SMART
Blast:IG	38	119	9e-27	BLAST
transmembrane domain	143	165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086401
AA Change: D53V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541
AA Change: D53V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	134	1e-78	PDB
SCOP:d1nkr_2	24	118	2e-9	SMART
Blast:IG	38	119	2e-26	BLAST
transmembrane domain	143	165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108600
AA Change: D53V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541
AA Change: D53V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	133	8e-79	PDB
SCOP:d1nkr_2	24	118	1e-9	SMART
Blast:IG	38	119	6e-27	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119711

SMART Domains

Protein: ENSMUSP00000113871
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	133	4e-79	PDB
SCOP:d1nkr_2	24	118	7e-9	SMART
Blast:IG	38	119	2e-27	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000131126

SMART Domains

Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136616

SMART Domains

Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000149395

SMART Domains

Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206445

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	G	5: 98,737,636	H134R	possibly damaging	Het
3632451O06Rik	A	T	14: 49,773,482	M256K	probably benign	Het
4931414P19Rik	T	C	14: 54,591,325	T240A	probably benign	Het
Abca15	T	C	7: 120,332,694	Y57H	probably benign	Het
Adgrf4	A	G	17: 42,666,529	I641T	possibly damaging	Het
Ankrd11	A	G	8: 122,889,821	Y2410H	probably damaging	Het
Apbb2	C	A	5: 66,452,261	L14F	probably null	Het
Arhgdia	T	C	11: 120,579,235	D204G	probably damaging	Het
Catsperd	A	T	17: 56,662,736	Y610F	possibly damaging	Het
Cblb	T	A	16: 52,033,103	D27E	probably damaging	Het
Ccdc180	A	T	4: 45,917,453	I893F	probably damaging	Het
Ccdc180	A	G	4: 45,917,508	H911R	probably damaging	Het
Cdh23	T	A	10: 60,307,935	I2966F	probably damaging	Het
Chat	G	A	14: 32,419,105	P445L	probably damaging	Het
Chdh	G	T	14: 30,032,852	R273L	possibly damaging	Het
Clic3	T	C	2: 25,457,917	V72A	probably benign	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Ddr1	T	A	17: 35,690,130	D241V	probably damaging	Het
Dock7	T	A	4: 99,020,077	K605N	probably damaging	Het
Dsg2	T	A	18: 20,579,430	F164I	probably damaging	Het
Dstyk	T	A	1: 132,453,106	N446K	probably damaging	Het
Epb42	A	T	2: 121,034,451	L53Q	probably damaging	Het
Extl2	G	C	3: 116,027,192	K229N	probably benign	Het
Frmd4b	T	A	6: 97,298,090	S617C	probably damaging	Het
Fscb	C	T	12: 64,473,814	V293I	probably benign	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm4978	A	C	9: 69,450,872		probably benign	Het
Gm6729	A	G	10: 86,540,388		noncoding transcript	Het
Gnat2	A	C	3: 108,100,616	N293T	probably benign	Het
Herpud1	T	C	8: 94,390,842	I142T	probably benign	Het
Irak2	G	A	6: 113,693,730	V536I	probably benign	Het
Kcnu1	A	T	8: 25,897,862		probably null	Het
Kdm4a	A	G	4: 118,161,754	S422P	probably benign	Het
Lhx1	G	T	11: 84,519,909	Y196*	probably null	Het
Lrrc37a	G	A	11: 103,497,612	T2329I	unknown	Het
Mag	T	C	7: 30,909,200	D163G	probably damaging	Het
Magi3	A	G	3: 104,051,392	V459A	probably damaging	Het
Med13	A	G	11: 86,288,118	Y1451H	probably damaging	Het
Megf8	T	A	7: 25,360,706	C2341S	probably damaging	Het
Mppe1	A	G	18: 67,228,024	C221R	probably damaging	Het
Mtus1	T	A	8: 41,041,478	H39L	possibly damaging	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nutm2	T	C	13: 50,474,873	C658R	possibly damaging	Het
Olfm1	T	C	2: 28,222,590	V239A	possibly damaging	Het
Pcnx	C	T	12: 81,917,793	H245Y	possibly damaging	Het
Pgm3	A	G	9: 86,559,476	L356S	probably damaging	Het
Pik3r4	C	G	9: 105,668,994	H207D	probably benign	Het
Pkd1l1	T	C	11: 8,844,585	T1859A	probably benign	Het
Pon3	A	T	6: 5,221,625	V335E	possibly damaging	Het
Ppp4r3b	A	G	11: 29,211,740	T705A	probably benign	Het
Prmt7	T	C	8: 106,237,278	V268A	probably benign	Het
Psd	C	T	19: 46,322,417	G398R	probably damaging	Het
Pygl	A	G	12: 70,206,381	V188A	probably damaging	Het
Rnf13	T	A	3: 57,796,206	N110K	probably damaging	Het
Rnf170	C	T	8: 26,125,911	Q77*	probably null	Het
Rrp8	A	T	7: 105,734,077	Y327*	probably null	Het
Ruvbl2	T	C	7: 45,424,726	D228G	probably damaging	Het
Scgn	T	A	13: 23,989,824	T35S	probably benign	Het
Scyl3	C	T	1: 163,934,747	P74S	probably damaging	Het
Sec61b	T	G	4: 47,483,074	S123A	probably benign	Het
Sertad2	T	C	11: 20,647,899	S32P	possibly damaging	Het
Slc23a3	T	C	1: 75,133,803		probably null	Het
Sult2a2	T	G	7: 13,738,298	V140G	probably benign	Het
Tbc1d4	A	T	14: 101,507,231	S320T	probably benign	Het
Trabd2b	T	C	4: 114,408,944	Y52H	probably damaging	Het
Traf2	T	C	2: 25,530,288	E183G	probably null	Het
Trip10	G	T	17: 57,263,017	V561F	possibly damaging	Het
Ttc7	G	T	17: 87,306,958	V184F	probably benign	Het
Ubc	A	G	5: 125,386,229	V678A	probably benign	Het
Unk	A	G	11: 116,053,665	E414G	possibly damaging	Het
Usp42	T	C	5: 143,719,762	N365D	probably damaging	Het
Zbtb26	A	T	2: 37,436,769	I85K	probably damaging	Het
Zfhx2	A	T	14: 55,066,434	H1364Q	possibly damaging	Het

Other mutations in Lair1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Lair1	APN	7	4028731	missense	probably benign	0.01
IGL01475:Lair1	APN	7	4009684	utr 3 prime	probably benign
IGL02696:Lair1	APN	7	4010849	intron	probably benign
IGL02749:Lair1	APN	7	4028901	missense	possibly damaging	0.50
R0396:Lair1	UTSW	7	4010786	missense	probably damaging	1.00
R0703:Lair1	UTSW	7	4010760	missense	probably null	0.99
R1053:Lair1	UTSW	7	4028785	missense	probably damaging	1.00
R1332:Lair1	UTSW	7	4010596	missense	possibly damaging	0.77
R1717:Lair1	UTSW	7	4010789	missense	probably damaging	1.00
R2022:Lair1	UTSW	7	4063064	splice site	probably null
R2509:Lair1	UTSW	7	4010783	missense	probably damaging	1.00
R3721:Lair1	UTSW	7	4010783	missense	probably damaging	1.00
R4021:Lair1	UTSW	7	4055916	critical splice donor site	probably null
R4784:Lair1	UTSW	7	4009732	missense	probably benign	0.15
R4873:Lair1	UTSW	7	4029034	missense	probably benign	0.05
R4875:Lair1	UTSW	7	4029034	missense	probably benign	0.05
R5125:Lair1	UTSW	7	4010489	missense	possibly damaging	0.92
R5178:Lair1	UTSW	7	4010489	missense	possibly damaging	0.92
R5888:Lair1	UTSW	7	4010845	missense	probably damaging	0.96
R5965:Lair1	UTSW	7	4029024	missense	possibly damaging	0.46
R6119:Lair1	UTSW	7	4028896	missense	probably benign	0.43
R6265:Lair1	UTSW	7	4055827	intron	probably benign
R6305:Lair1	UTSW	7	4010728	critical splice donor site	probably null
R6915:Lair1	UTSW	7	4055953	missense	possibly damaging	0.89
R7964:Lair1	UTSW	7	4010804	missense	probably benign	0.22
R7991:Lair1	UTSW	7	4028970	missense	probably damaging	1.00
R9414:Lair1	UTSW	7	4010820	missense	probably benign	0.09
R9787:Lair1	UTSW	7	4010795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAACCTGAGGTTGGACC -3'
(R):5'- ATGGATTGGTGCACCTAAATTGG -3'

Sequencing Primer
(F):5'- CGTCTTACTACGTTCGGACCAGG -3'
(R):5'- CACCTAAATTGGTTTTCTGTTATGGC -3'

Posted On

2016-04-27