Incidental Mutation 'R4940:Lair1'
ID 382997
Institutional Source Beutler Lab
Gene Symbol Lair1
Ensembl Gene ENSMUSG00000055541
Gene Name leukocyte-associated Ig-like receptor 1
Synonyms 5133400O11Rik, Lair-1, D7Bwg0421e, mLair-1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4940 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 4006401-4066203 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4031948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 53 (D53V)
Ref Sequence ENSEMBL: ENSMUSP00000104241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000205296] [ENSMUST00000136616] [ENSMUST00000149395]
AlphaFold Q8BG84
Predicted Effect probably benign
Transcript: ENSMUST00000068865
SMART Domains Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086400
AA Change: D53V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541
AA Change: D53V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 5e-79 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 9e-27 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086401
AA Change: D53V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541
AA Change: D53V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 1e-78 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 2e-26 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108600
AA Change: D53V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541
AA Change: D53V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 8e-79 PDB
SCOP:d1nkr_2 24 118 1e-9 SMART
Blast:IG 38 119 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119711
SMART Domains Protein: ENSMUSP00000113871
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 4e-79 PDB
SCOP:d1nkr_2 24 118 7e-9 SMART
Blast:IG 38 119 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131126
SMART Domains Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206445
Predicted Effect probably benign
Transcript: ENSMUST00000136616
SMART Domains Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149395
SMART Domains Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,828,782 (GRCm39) T240A probably benign Het
Abca15 T C 7: 119,931,917 (GRCm39) Y57H probably benign Het
Adgrf4 A G 17: 42,977,420 (GRCm39) I641T possibly damaging Het
Ankrd11 A G 8: 123,616,560 (GRCm39) Y2410H probably damaging Het
Apbb2 C A 5: 66,609,604 (GRCm39) L14F probably null Het
Arhgdia T C 11: 120,470,061 (GRCm39) D204G probably damaging Het
Armh4 A T 14: 50,010,939 (GRCm39) M256K probably benign Het
Catsperd A T 17: 56,969,736 (GRCm39) Y610F possibly damaging Het
Cblb T A 16: 51,853,466 (GRCm39) D27E probably damaging Het
Ccdc180 A T 4: 45,917,453 (GRCm39) I893F probably damaging Het
Ccdc180 A G 4: 45,917,508 (GRCm39) H911R probably damaging Het
Cdh23 T A 10: 60,143,714 (GRCm39) I2966F probably damaging Het
Cfap299 A G 5: 98,885,495 (GRCm39) H134R possibly damaging Het
Chat G A 14: 32,141,062 (GRCm39) P445L probably damaging Het
Chdh G T 14: 29,754,809 (GRCm39) R273L possibly damaging Het
Clic3 T C 2: 25,347,929 (GRCm39) V72A probably benign Het
Cyp2d12 T A 15: 82,442,251 (GRCm39) D244E probably benign Het
Ddr1 T A 17: 36,001,022 (GRCm39) D241V probably damaging Het
Dock7 T A 4: 98,908,314 (GRCm39) K605N probably damaging Het
Dsg2 T A 18: 20,712,487 (GRCm39) F164I probably damaging Het
Dstyk T A 1: 132,380,844 (GRCm39) N446K probably damaging Het
Epb42 A T 2: 120,864,932 (GRCm39) L53Q probably damaging Het
Extl2 G C 3: 115,820,841 (GRCm39) K229N probably benign Het
Frmd4b T A 6: 97,275,051 (GRCm39) S617C probably damaging Het
Fscb C T 12: 64,520,588 (GRCm39) V293I probably benign Het
Glp2r G T 11: 67,648,419 (GRCm39) Y94* probably null Het
Gm4978 A C 9: 69,358,154 (GRCm39) probably benign Het
Gm6729 A G 10: 86,376,252 (GRCm39) noncoding transcript Het
Gnat2 A C 3: 108,007,932 (GRCm39) N293T probably benign Het
Herpud1 T C 8: 95,117,470 (GRCm39) I142T probably benign Het
Irak2 G A 6: 113,670,691 (GRCm39) V536I probably benign Het
Kcnu1 A T 8: 26,387,890 (GRCm39) probably null Het
Kdm4a A G 4: 118,018,951 (GRCm39) S422P probably benign Het
Lhx1 G T 11: 84,410,735 (GRCm39) Y196* probably null Het
Lrrc37a G A 11: 103,388,438 (GRCm39) T2329I unknown Het
Mag T C 7: 30,608,625 (GRCm39) D163G probably damaging Het
Magi3 A G 3: 103,958,708 (GRCm39) V459A probably damaging Het
Med13 A G 11: 86,178,944 (GRCm39) Y1451H probably damaging Het
Megf8 T A 7: 25,060,131 (GRCm39) C2341S probably damaging Het
Mppe1 A G 18: 67,361,095 (GRCm39) C221R probably damaging Het
Mtus1 T A 8: 41,494,515 (GRCm39) H39L possibly damaging Het
Nkpd1 C T 7: 19,257,498 (GRCm39) Q276* probably null Het
Nkx3-1 G A 14: 69,428,367 (GRCm39) G72S probably benign Het
Nutm2 T C 13: 50,628,909 (GRCm39) C658R possibly damaging Het
Olfm1 T C 2: 28,112,602 (GRCm39) V239A possibly damaging Het
Pcnx1 C T 12: 81,964,567 (GRCm39) H245Y possibly damaging Het
Pgm3 A G 9: 86,441,529 (GRCm39) L356S probably damaging Het
Pik3r4 C G 9: 105,546,193 (GRCm39) H207D probably benign Het
Pkd1l1 T C 11: 8,794,585 (GRCm39) T1859A probably benign Het
Pon3 A T 6: 5,221,625 (GRCm39) V335E possibly damaging Het
Ppp4r3b A G 11: 29,161,740 (GRCm39) T705A probably benign Het
Prmt7 T C 8: 106,963,910 (GRCm39) V268A probably benign Het
Psd C T 19: 46,310,856 (GRCm39) G398R probably damaging Het
Pygl A G 12: 70,253,155 (GRCm39) V188A probably damaging Het
Rnf13 T A 3: 57,703,627 (GRCm39) N110K probably damaging Het
Rnf170 C T 8: 26,615,939 (GRCm39) Q77* probably null Het
Rrp8 A T 7: 105,383,284 (GRCm39) Y327* probably null Het
Ruvbl2 T C 7: 45,074,150 (GRCm39) D228G probably damaging Het
Scgn T A 13: 24,173,807 (GRCm39) T35S probably benign Het
Scyl3 C T 1: 163,762,316 (GRCm39) P74S probably damaging Het
Sec61b T G 4: 47,483,074 (GRCm39) S123A probably benign Het
Sertad2 T C 11: 20,597,899 (GRCm39) S32P possibly damaging Het
Slc23a3 T C 1: 75,110,447 (GRCm39) probably null Het
Sult2a2 T G 7: 13,472,223 (GRCm39) V140G probably benign Het
Tbc1d4 A T 14: 101,744,667 (GRCm39) S320T probably benign Het
Trabd2b T C 4: 114,266,141 (GRCm39) Y52H probably damaging Het
Traf2 T C 2: 25,420,300 (GRCm39) E183G probably null Het
Trip10 G T 17: 57,570,017 (GRCm39) V561F possibly damaging Het
Ttc7 G T 17: 87,614,386 (GRCm39) V184F probably benign Het
Ubc A G 5: 125,463,293 (GRCm39) V678A probably benign Het
Unk A G 11: 115,944,491 (GRCm39) E414G possibly damaging Het
Usp42 T C 5: 143,705,517 (GRCm39) N365D probably damaging Het
Zbtb26 A T 2: 37,326,781 (GRCm39) I85K probably damaging Het
Zfhx2 A T 14: 55,303,891 (GRCm39) H1364Q possibly damaging Het
Other mutations in Lair1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lair1 APN 7 4,031,730 (GRCm39) missense probably benign 0.01
IGL01475:Lair1 APN 7 4,012,683 (GRCm39) utr 3 prime probably benign
IGL02696:Lair1 APN 7 4,013,848 (GRCm39) intron probably benign
IGL02749:Lair1 APN 7 4,031,900 (GRCm39) missense possibly damaging 0.50
R0396:Lair1 UTSW 7 4,013,785 (GRCm39) missense probably damaging 1.00
R0703:Lair1 UTSW 7 4,013,759 (GRCm39) missense probably null 0.99
R1053:Lair1 UTSW 7 4,031,784 (GRCm39) missense probably damaging 1.00
R1332:Lair1 UTSW 7 4,013,595 (GRCm39) missense possibly damaging 0.77
R1717:Lair1 UTSW 7 4,013,788 (GRCm39) missense probably damaging 1.00
R2022:Lair1 UTSW 7 4,066,063 (GRCm39) splice site probably null
R2509:Lair1 UTSW 7 4,013,782 (GRCm39) missense probably damaging 1.00
R3721:Lair1 UTSW 7 4,013,782 (GRCm39) missense probably damaging 1.00
R4021:Lair1 UTSW 7 4,058,915 (GRCm39) critical splice donor site probably null
R4784:Lair1 UTSW 7 4,012,731 (GRCm39) missense probably benign 0.15
R4873:Lair1 UTSW 7 4,032,033 (GRCm39) missense probably benign 0.05
R4875:Lair1 UTSW 7 4,032,033 (GRCm39) missense probably benign 0.05
R5125:Lair1 UTSW 7 4,013,488 (GRCm39) missense possibly damaging 0.92
R5178:Lair1 UTSW 7 4,013,488 (GRCm39) missense possibly damaging 0.92
R5888:Lair1 UTSW 7 4,013,844 (GRCm39) missense probably damaging 0.96
R5965:Lair1 UTSW 7 4,032,023 (GRCm39) missense possibly damaging 0.46
R6119:Lair1 UTSW 7 4,031,895 (GRCm39) missense probably benign 0.43
R6265:Lair1 UTSW 7 4,058,826 (GRCm39) intron probably benign
R6305:Lair1 UTSW 7 4,013,727 (GRCm39) critical splice donor site probably null
R6915:Lair1 UTSW 7 4,058,952 (GRCm39) missense possibly damaging 0.89
R7964:Lair1 UTSW 7 4,013,803 (GRCm39) missense probably benign 0.22
R7991:Lair1 UTSW 7 4,031,969 (GRCm39) missense probably damaging 1.00
R9414:Lair1 UTSW 7 4,013,819 (GRCm39) missense probably benign 0.09
R9787:Lair1 UTSW 7 4,013,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAACCTGAGGTTGGACC -3'
(R):5'- ATGGATTGGTGCACCTAAATTGG -3'

Sequencing Primer
(F):5'- CGTCTTACTACGTTCGGACCAGG -3'
(R):5'- CACCTAAATTGGTTTTCTGTTATGGC -3'
Posted On 2016-04-27