Mutagenetix > Incidental Mutation

Incidental Mutation 'R4940:Megf8'

383000

Institutional Source

Beutler Lab

Gene Symbol

Megf8

Ensembl Gene

ENSMUSG00000045039

Gene Name

multiple EGF-like-domains 8

Synonyms

Egfl4, b2b1702Clo, m687Ddg, b2b288Clo

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R4940 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25317164-25365917 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25360706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 2341 (C2341S)

Ref Sequence

ENSEMBL: ENSMUSP00000122192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128119]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000128119
AA Change: C2341S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: C2341S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CUB	33	140	1.24e-15	SMART
EGF	141	170	4.26e0	SMART
EGF	173	203	2.43e1	SMART
Pfam:Kelch_4	227	277	1.3e-11	PFAM
Pfam:Kelch_3	240	287	1.6e-7	PFAM
low complexity region	320	341	N/A	INTRINSIC
low complexity region	517	531	N/A	INTRINSIC
low complexity region	728	738	N/A	INTRINSIC
PSI	847	899	1.37e0	SMART
low complexity region	932	938	N/A	INTRINSIC
PSI	949	991	2.11e-2	SMART
PSI	1005	1073	7.82e-1	SMART
EGF_CA	1074	1115	2.62e-9	SMART
EGF	1117	1160	5.4e-2	SMART
EGF_like	1163	1208	4e-1	SMART
EGF_Lam	1211	1259	1.03e-7	SMART
Blast:CUB	1263	1401	1e-30	BLAST
EGF_like	1406	1445	3.29e1	SMART
Pfam:Kelch_4	1509	1564	6.5e-12	PFAM
Pfam:Kelch_3	1520	1574	1.2e-10	PFAM
PSI	1868	1923	2.75e-1	SMART
PSI	2004	2062	1.6e0	SMART
PSI	2064	2121	1.68e-5	SMART
EGF	2125	2164	1.08e-1	SMART
EGF	2166	2194	4.26e0	SMART
EGF	2204	2244	2.2e1	SMART
EGF_like	2248	2321	6.37e-1	SMART
low complexity region	2493	2504	N/A	INTRINSIC
low complexity region	2530	2541	N/A	INTRINSIC
transmembrane domain	2592	2614	N/A	INTRINSIC
low complexity region	2649	2668	N/A	INTRINSIC
low complexity region	2674	2702	N/A	INTRINSIC
low complexity region	2759	2774	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153077

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	G	5: 98,737,636	H134R	possibly damaging	Het
3632451O06Rik	A	T	14: 49,773,482	M256K	probably benign	Het
4931414P19Rik	T	C	14: 54,591,325	T240A	probably benign	Het
Abca15	T	C	7: 120,332,694	Y57H	probably benign	Het
Adgrf4	A	G	17: 42,666,529	I641T	possibly damaging	Het
Ankrd11	A	G	8: 122,889,821	Y2410H	probably damaging	Het
Apbb2	C	A	5: 66,452,261	L14F	probably null	Het
Arhgdia	T	C	11: 120,579,235	D204G	probably damaging	Het
Catsperd	A	T	17: 56,662,736	Y610F	possibly damaging	Het
Cblb	T	A	16: 52,033,103	D27E	probably damaging	Het
Ccdc180	A	T	4: 45,917,453	I893F	probably damaging	Het
Ccdc180	A	G	4: 45,917,508	H911R	probably damaging	Het
Cdh23	T	A	10: 60,307,935	I2966F	probably damaging	Het
Chat	G	A	14: 32,419,105	P445L	probably damaging	Het
Chdh	G	T	14: 30,032,852	R273L	possibly damaging	Het
Clic3	T	C	2: 25,457,917	V72A	probably benign	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Ddr1	T	A	17: 35,690,130	D241V	probably damaging	Het
Dock7	T	A	4: 99,020,077	K605N	probably damaging	Het
Dsg2	T	A	18: 20,579,430	F164I	probably damaging	Het
Dstyk	T	A	1: 132,453,106	N446K	probably damaging	Het
Epb42	A	T	2: 121,034,451	L53Q	probably damaging	Het
Extl2	G	C	3: 116,027,192	K229N	probably benign	Het
Frmd4b	T	A	6: 97,298,090	S617C	probably damaging	Het
Fscb	C	T	12: 64,473,814	V293I	probably benign	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm4978	A	C	9: 69,450,872		probably benign	Het
Gm6729	A	G	10: 86,540,388		noncoding transcript	Het
Gnat2	A	C	3: 108,100,616	N293T	probably benign	Het
Herpud1	T	C	8: 94,390,842	I142T	probably benign	Het
Irak2	G	A	6: 113,693,730	V536I	probably benign	Het
Kcnu1	A	T	8: 25,897,862		probably null	Het
Kdm4a	A	G	4: 118,161,754	S422P	probably benign	Het
Lair1	T	A	7: 4,028,949	D53V	probably benign	Het
Lhx1	G	T	11: 84,519,909	Y196*	probably null	Het
Lrrc37a	G	A	11: 103,497,612	T2329I	unknown	Het
Mag	T	C	7: 30,909,200	D163G	probably damaging	Het
Magi3	A	G	3: 104,051,392	V459A	probably damaging	Het
Med13	A	G	11: 86,288,118	Y1451H	probably damaging	Het
Mppe1	A	G	18: 67,228,024	C221R	probably damaging	Het
Mtus1	T	A	8: 41,041,478	H39L	possibly damaging	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nutm2	T	C	13: 50,474,873	C658R	possibly damaging	Het
Olfm1	T	C	2: 28,222,590	V239A	possibly damaging	Het
Pcnx	C	T	12: 81,917,793	H245Y	possibly damaging	Het
Pgm3	A	G	9: 86,559,476	L356S	probably damaging	Het
Pik3r4	C	G	9: 105,668,994	H207D	probably benign	Het
Pkd1l1	T	C	11: 8,844,585	T1859A	probably benign	Het
Pon3	A	T	6: 5,221,625	V335E	possibly damaging	Het
Ppp4r3b	A	G	11: 29,211,740	T705A	probably benign	Het
Prmt7	T	C	8: 106,237,278	V268A	probably benign	Het
Psd	C	T	19: 46,322,417	G398R	probably damaging	Het
Pygl	A	G	12: 70,206,381	V188A	probably damaging	Het
Rnf13	T	A	3: 57,796,206	N110K	probably damaging	Het
Rnf170	C	T	8: 26,125,911	Q77*	probably null	Het
Rrp8	A	T	7: 105,734,077	Y327*	probably null	Het
Ruvbl2	T	C	7: 45,424,726	D228G	probably damaging	Het
Scgn	T	A	13: 23,989,824	T35S	probably benign	Het
Scyl3	C	T	1: 163,934,747	P74S	probably damaging	Het
Sec61b	T	G	4: 47,483,074	S123A	probably benign	Het
Sertad2	T	C	11: 20,647,899	S32P	possibly damaging	Het
Slc23a3	T	C	1: 75,133,803		probably null	Het
Sult2a2	T	G	7: 13,738,298	V140G	probably benign	Het
Tbc1d4	A	T	14: 101,507,231	S320T	probably benign	Het
Trabd2b	T	C	4: 114,408,944	Y52H	probably damaging	Het
Traf2	T	C	2: 25,530,288	E183G	probably null	Het
Trip10	G	T	17: 57,263,017	V561F	possibly damaging	Het
Ttc7	G	T	17: 87,306,958	V184F	probably benign	Het
Ubc	A	G	5: 125,386,229	V678A	probably benign	Het
Unk	A	G	11: 116,053,665	E414G	possibly damaging	Het
Usp42	T	C	5: 143,719,762	N365D	probably damaging	Het
Zbtb26	A	T	2: 37,436,769	I85K	probably damaging	Het
Zfhx2	A	T	14: 55,066,434	H1364Q	possibly damaging	Het

Other mutations in Megf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Megf8	APN	7	25343684	missense	possibly damaging	0.87
IGL00696:Megf8	APN	7	25342392	missense	probably benign
IGL01021:Megf8	APN	7	25338374	missense	probably benign	0.39
IGL01290:Megf8	APN	7	25349658	nonsense	probably null
IGL01392:Megf8	APN	7	25363749	missense	probably benign	0.03
IGL01410:Megf8	APN	7	25359871	missense	probably benign	0.01
IGL01634:Megf8	APN	7	25358781	splice site	probably benign
IGL01648:Megf8	APN	7	25327572	missense	probably damaging	1.00
IGL01930:Megf8	APN	7	25334861	missense	probably damaging	1.00
IGL01954:Megf8	APN	7	25349014	missense	possibly damaging	0.94
IGL02150:Megf8	APN	7	25346417	splice site	probably null
IGL02192:Megf8	APN	7	25353860	missense	probably damaging	1.00
IGL02250:Megf8	APN	7	25342575	missense	probably benign	0.02
IGL02301:Megf8	APN	7	25337900	missense	probably damaging	0.96
IGL02317:Megf8	APN	7	25363788	missense	probably damaging	1.00
IGL02324:Megf8	APN	7	25340448	missense	probably benign	0.10
IGL02503:Megf8	APN	7	25363563	missense	possibly damaging	0.70
IGL02583:Megf8	APN	7	25355793	missense	probably benign
IGL02636:Megf8	APN	7	25358432	missense	probably damaging	0.99
IGL02704:Megf8	APN	7	25359782	missense	probably damaging	0.97
IGL02898:Megf8	APN	7	25346508	missense	possibly damaging	0.79
IGL03082:Megf8	APN	7	25330236	missense	probably benign
IGL03182:Megf8	APN	7	25347348	missense	possibly damaging	0.92
megatherium	UTSW	7	25342425	critical splice donor site	probably null
PIT4810001:Megf8	UTSW	7	25342285	missense	probably damaging	1.00
R0076:Megf8	UTSW	7	25353958	critical splice donor site	probably null
R0217:Megf8	UTSW	7	25364079	missense	probably damaging	0.99
R0514:Megf8	UTSW	7	25364303	missense	possibly damaging	0.86
R0561:Megf8	UTSW	7	25328832	missense	probably benign	0.21
R0563:Megf8	UTSW	7	25342395	missense	probably damaging	1.00
R0601:Megf8	UTSW	7	25328540	missense	probably benign	0.03
R0879:Megf8	UTSW	7	25338471	missense	possibly damaging	0.58
R1323:Megf8	UTSW	7	25360102	splice site	probably null
R1323:Megf8	UTSW	7	25360102	splice site	probably null
R1430:Megf8	UTSW	7	25364343	missense	possibly damaging	0.86
R1445:Megf8	UTSW	7	25342656	missense	probably damaging	0.97
R1533:Megf8	UTSW	7	25334855	missense	possibly damaging	0.70
R1606:Megf8	UTSW	7	25358695	missense	probably damaging	1.00
R1635:Megf8	UTSW	7	25346747	missense	possibly damaging	0.77
R1654:Megf8	UTSW	7	25338486	missense	possibly damaging	0.56
R1661:Megf8	UTSW	7	25363847	missense	probably damaging	1.00
R1880:Megf8	UTSW	7	25334860	missense	possibly damaging	0.68
R1962:Megf8	UTSW	7	25363551	missense	probably damaging	1.00
R2077:Megf8	UTSW	7	25353738	missense	probably benign	0.15
R2127:Megf8	UTSW	7	25364582	missense	possibly damaging	0.73
R2129:Megf8	UTSW	7	25330715	missense	probably damaging	0.98
R2199:Megf8	UTSW	7	25339614	missense	possibly damaging	0.87
R2201:Megf8	UTSW	7	25340745	missense	probably damaging	1.00
R2205:Megf8	UTSW	7	25341748	missense	probably benign	0.13
R2207:Megf8	UTSW	7	25349797	missense	probably damaging	0.97
R2361:Megf8	UTSW	7	25348954	missense	possibly damaging	0.94
R2680:Megf8	UTSW	7	25317556	missense	probably benign	0.01
R3084:Megf8	UTSW	7	25349019	missense	probably damaging	1.00
R3085:Megf8	UTSW	7	25349019	missense	probably damaging	1.00
R3086:Megf8	UTSW	7	25349019	missense	probably damaging	1.00
R3433:Megf8	UTSW	7	25360124	missense	probably benign	0.00
R3939:Megf8	UTSW	7	25359202	missense	probably benign	0.07
R4022:Megf8	UTSW	7	25337775	missense	probably damaging	1.00
R4214:Megf8	UTSW	7	25355368	missense	probably benign	0.03
R4357:Megf8	UTSW	7	25355749	missense	probably benign	0.02
R4521:Megf8	UTSW	7	25342701	missense	probably benign	0.19
R4620:Megf8	UTSW	7	25355098	missense	possibly damaging	0.92
R4700:Megf8	UTSW	7	25363515	missense	probably damaging	1.00
R4916:Megf8	UTSW	7	25339664	missense	probably benign	0.24
R5048:Megf8	UTSW	7	25331092	missense	possibly damaging	0.71
R5258:Megf8	UTSW	7	25348326	missense	possibly damaging	0.88
R5271:Megf8	UTSW	7	25341706	missense	probably damaging	1.00
R5390:Megf8	UTSW	7	25340289	missense	possibly damaging	0.92
R5391:Megf8	UTSW	7	25340289	missense	possibly damaging	0.92
R5708:Megf8	UTSW	7	25334597	missense	probably benign	0.03
R5752:Megf8	UTSW	7	25355114	missense	probably damaging	0.97
R5930:Megf8	UTSW	7	25326441	nonsense	probably null
R6037:Megf8	UTSW	7	25364406	missense	probably damaging	1.00
R6037:Megf8	UTSW	7	25364406	missense	probably damaging	1.00
R6153:Megf8	UTSW	7	25347371	missense	possibly damaging	0.93
R6210:Megf8	UTSW	7	25343720	missense	possibly damaging	0.90
R6457:Megf8	UTSW	7	25349695	missense	probably damaging	0.99
R6659:Megf8	UTSW	7	25358734	missense	probably benign	0.38
R6867:Megf8	UTSW	7	25331035	missense	probably benign	0.42
R6896:Megf8	UTSW	7	25329932	missense	probably benign	0.00
R6899:Megf8	UTSW	7	25360713	missense	probably damaging	1.00
R6905:Megf8	UTSW	7	25337932	missense	probably benign	0.02
R7099:Megf8	UTSW	7	25346520	missense	probably damaging	0.99
R7172:Megf8	UTSW	7	25343667	missense	probably damaging	0.99
R7378:Megf8	UTSW	7	25348942	missense	probably damaging	1.00
R7427:Megf8	UTSW	7	25338371	missense	probably benign	0.44
R7492:Megf8	UTSW	7	25353848	missense	probably benign	0.24
R7699:Megf8	UTSW	7	25329928	missense	possibly damaging	0.91
R7700:Megf8	UTSW	7	25329928	missense	possibly damaging	0.91
R7756:Megf8	UTSW	7	25342425	critical splice donor site	probably null
R7758:Megf8	UTSW	7	25342425	critical splice donor site	probably null
R7786:Megf8	UTSW	7	25317695	critical splice donor site	probably null
R7797:Megf8	UTSW	7	25334597	missense	probably damaging	0.99
R7881:Megf8	UTSW	7	25340635	missense	possibly damaging	0.72
R8165:Megf8	UTSW	7	25353873	missense	probably damaging	1.00
R8258:Megf8	UTSW	7	25358423	missense	probably benign	0.03
R8259:Megf8	UTSW	7	25358423	missense	probably benign	0.03
R8328:Megf8	UTSW	7	25347492	missense	probably benign	0.05
R8362:Megf8	UTSW	7	25340518	missense	probably benign	0.04
R8680:Megf8	UTSW	7	25359741	critical splice acceptor site	probably null
R9080:Megf8	UTSW	7	25341706	missense	probably damaging	1.00
R9297:Megf8	UTSW	7	25331086	missense	probably damaging	0.99
R9314:Megf8	UTSW	7	25329872	missense	probably damaging	0.98
R9378:Megf8	UTSW	7	25340415	critical splice acceptor site	probably null
R9530:Megf8	UTSW	7	25330699	missense	probably benign	0.30
R9557:Megf8	UTSW	7	25359086	missense	possibly damaging	0.86
R9592:Megf8	UTSW	7	25328803	missense	probably benign	0.29
R9612:Megf8	UTSW	7	25355063	missense	probably benign	0.40
R9629:Megf8	UTSW	7	25343769	missense	possibly damaging	0.76
R9643:Megf8	UTSW	7	25347482	missense	probably damaging	1.00
R9666:Megf8	UTSW	7	25330741	missense	possibly damaging	0.65
R9745:Megf8	UTSW	7	25358708	missense	possibly damaging	0.62
Z1088:Megf8	UTSW	7	25339669	missense	possibly damaging	0.87
Z1177:Megf8	UTSW	7	25346162	missense	probably damaging	1.00
Z1177:Megf8	UTSW	7	25347369	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTGCCTGCCCTTCTGAAAC -3'
(R):5'- ATGTACAAGATGACCTCCATTCC -3'

Sequencing Primer
(F):5'- TGGAAGTCAGAGCATAGC -3'
(R):5'- GATGACCTCCATTCCAAACCAGG -3'

Posted On

2016-04-27