Incidental Mutation 'R4940:Rrp8'
ID383004
Institutional Source Beutler Lab
Gene Symbol Rrp8
Ensembl Gene ENSMUSG00000030888
Gene Nameribosomal RNA processing 8, methyltransferase, homolog (yeast)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4940 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105731730-105737385 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105734077 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 327 (Y327*)
Ref Sequence ENSEMBL: ENSMUSP00000095752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033179] [ENSMUST00000033182] [ENSMUST00000098148] [ENSMUST00000136687] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect probably null
Transcript: ENSMUST00000033179
AA Change: Y281*
SMART Domains Protein: ENSMUSP00000033179
Gene: ENSMUSG00000030888
AA Change: Y281*

DomainStartEndE-ValueType
low complexity region 186 202 N/A INTRINSIC
Pfam:Methyltransf_8 238 457 2.4e-107 PFAM
Pfam:Methyltransf_11 314 391 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033182
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098148
AA Change: Y327*
SMART Domains Protein: ENSMUSP00000095752
Gene: ENSMUSG00000030888
AA Change: Y327*

DomainStartEndE-ValueType
low complexity region 232 248 N/A INTRINSIC
Pfam:Methyltransf_8 284 503 7.5e-107 PFAM
Pfam:Methyltransf_11 348 437 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127738
Predicted Effect probably benign
Transcript: ENSMUST00000136687
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148176
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154852
Predicted Effect probably benign
Transcript: ENSMUST00000163389
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,737,636 H134R possibly damaging Het
3632451O06Rik A T 14: 49,773,482 M256K probably benign Het
4931414P19Rik T C 14: 54,591,325 T240A probably benign Het
Abca15 T C 7: 120,332,694 Y57H probably benign Het
Adgrf4 A G 17: 42,666,529 I641T possibly damaging Het
Ankrd11 A G 8: 122,889,821 Y2410H probably damaging Het
Apbb2 C A 5: 66,452,261 L14F probably null Het
Arhgdia T C 11: 120,579,235 D204G probably damaging Het
Catsperd A T 17: 56,662,736 Y610F possibly damaging Het
Cblb T A 16: 52,033,103 D27E probably damaging Het
Ccdc180 A T 4: 45,917,453 I893F probably damaging Het
Ccdc180 A G 4: 45,917,508 H911R probably damaging Het
Cdh23 T A 10: 60,307,935 I2966F probably damaging Het
Chat G A 14: 32,419,105 P445L probably damaging Het
Chdh G T 14: 30,032,852 R273L possibly damaging Het
Clic3 T C 2: 25,457,917 V72A probably benign Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Ddr1 T A 17: 35,690,130 D241V probably damaging Het
Dock7 T A 4: 99,020,077 K605N probably damaging Het
Dsg2 T A 18: 20,579,430 F164I probably damaging Het
Dstyk T A 1: 132,453,106 N446K probably damaging Het
Epb42 A T 2: 121,034,451 L53Q probably damaging Het
Extl2 G C 3: 116,027,192 K229N probably benign Het
Frmd4b T A 6: 97,298,090 S617C probably damaging Het
Fscb C T 12: 64,473,814 V293I probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm4978 A C 9: 69,450,872 probably benign Het
Gm6729 A G 10: 86,540,388 noncoding transcript Het
Gnat2 A C 3: 108,100,616 N293T probably benign Het
Herpud1 T C 8: 94,390,842 I142T probably benign Het
Irak2 G A 6: 113,693,730 V536I probably benign Het
Kcnu1 A T 8: 25,897,862 probably null Het
Kdm4a A G 4: 118,161,754 S422P probably benign Het
Lair1 T A 7: 4,028,949 D53V probably benign Het
Lhx1 G T 11: 84,519,909 Y196* probably null Het
Lrrc37a G A 11: 103,497,612 T2329I unknown Het
Mag T C 7: 30,909,200 D163G probably damaging Het
Magi3 A G 3: 104,051,392 V459A probably damaging Het
Med13 A G 11: 86,288,118 Y1451H probably damaging Het
Megf8 T A 7: 25,360,706 C2341S probably damaging Het
Mppe1 A G 18: 67,228,024 C221R probably damaging Het
Mtus1 T A 8: 41,041,478 H39L possibly damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nutm2 T C 13: 50,474,873 C658R possibly damaging Het
Olfm1 T C 2: 28,222,590 V239A possibly damaging Het
Pcnx C T 12: 81,917,793 H245Y possibly damaging Het
Pgm3 A G 9: 86,559,476 L356S probably damaging Het
Pik3r4 C G 9: 105,668,994 H207D probably benign Het
Pkd1l1 T C 11: 8,844,585 T1859A probably benign Het
Pon3 A T 6: 5,221,625 V335E possibly damaging Het
Ppp4r3b A G 11: 29,211,740 T705A probably benign Het
Prmt7 T C 8: 106,237,278 V268A probably benign Het
Psd C T 19: 46,322,417 G398R probably damaging Het
Pygl A G 12: 70,206,381 V188A probably damaging Het
Rnf13 T A 3: 57,796,206 N110K probably damaging Het
Rnf170 C T 8: 26,125,911 Q77* probably null Het
Ruvbl2 T C 7: 45,424,726 D228G probably damaging Het
Scgn T A 13: 23,989,824 T35S probably benign Het
Scyl3 C T 1: 163,934,747 P74S probably damaging Het
Sec61b T G 4: 47,483,074 S123A probably benign Het
Sertad2 T C 11: 20,647,899 S32P possibly damaging Het
Slc23a3 T C 1: 75,133,803 probably null Het
Sult2a2 T G 7: 13,738,298 V140G probably benign Het
Tbc1d4 A T 14: 101,507,231 S320T probably benign Het
Trabd2b T C 4: 114,408,944 Y52H probably damaging Het
Traf2 T C 2: 25,530,288 E183G probably null Het
Trip10 G T 17: 57,263,017 V561F possibly damaging Het
Ttc7 G T 17: 87,306,958 V184F probably benign Het
Ubc A G 5: 125,386,229 V678A probably benign Het
Unk A G 11: 116,053,665 E414G possibly damaging Het
Usp42 T C 5: 143,719,762 N365D probably damaging Het
Zbtb26 A T 2: 37,436,769 I85K probably damaging Het
Zfhx2 A T 14: 55,066,434 H1364Q possibly damaging Het
Other mutations in Rrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rrp8 APN 7 105733016 unclassified probably benign
IGL02792:Rrp8 APN 7 105733811 nonsense probably null
IGL03010:Rrp8 APN 7 105734391 missense probably benign 0.01
IGL03404:Rrp8 APN 7 105734938 missense probably benign 0.41
IGL03046:Rrp8 UTSW 7 105734902 missense probably benign 0.00
R0682:Rrp8 UTSW 7 105734011 missense probably damaging 0.97
R2314:Rrp8 UTSW 7 105734804 missense probably benign 0.37
R4222:Rrp8 UTSW 7 105734022 missense possibly damaging 0.86
R4778:Rrp8 UTSW 7 105737274 intron probably benign
R5315:Rrp8 UTSW 7 105734000 missense probably benign 0.00
R5480:Rrp8 UTSW 7 105734129 missense probably damaging 1.00
R5630:Rrp8 UTSW 7 105733401 missense possibly damaging 0.83
R6266:Rrp8 UTSW 7 105736389 missense probably damaging 1.00
R6351:Rrp8 UTSW 7 105734809 missense probably damaging 0.99
R6353:Rrp8 UTSW 7 105734118 nonsense probably null
R7070:Rrp8 UTSW 7 105734876 missense possibly damaging 0.90
R7092:Rrp8 UTSW 7 105734109 missense probably damaging 1.00
R7632:Rrp8 UTSW 7 105736520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TACCACTAAGGATGCAGGCCTG -3'
(R):5'- TCCCAAGGCTTCCATAGAGG -3'

Sequencing Primer
(F):5'- ATGCAGGCCTGGGAGTG -3'
(R):5'- TAGAGGAGACTGAGGTGCCTCC -3'
Posted On2016-04-27