Incidental Mutation 'R4940:Mtus1'
ID383009
Institutional Source Beutler Lab
Gene Symbol Mtus1
Ensembl Gene ENSMUSG00000045636
Gene Namemitochondrial tumor suppressor 1
SynonymsB430305I03Rik, MD44, MTSG1, Atip1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R4940 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40990914-41133726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41041478 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 39 (H39L)
Ref Sequence ENSEMBL: ENSMUSP00000053554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051379] [ENSMUST00000059115] [ENSMUST00000093534] [ENSMUST00000118835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051379
AA Change: H39L

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053554
Gene: ENSMUSG00000045636
AA Change: H39L

DomainStartEndE-ValueType
coiled coil region 106 168 N/A INTRINSIC
coiled coil region 193 375 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059115
SMART Domains Protein: ENSMUSP00000059503
Gene: ENSMUSG00000045636

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093534
SMART Domains Protein: ENSMUSP00000091252
Gene: ENSMUSG00000045636

DomainStartEndE-ValueType
coiled coil region 186 248 N/A INTRINSIC
coiled coil region 273 455 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118835
SMART Domains Protein: ENSMUSP00000112626
Gene: ENSMUSG00000045636

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155174
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit spontaneous heart hypertrophy and SLE-like lymphoproliferative disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,737,636 H134R possibly damaging Het
3632451O06Rik A T 14: 49,773,482 M256K probably benign Het
4931414P19Rik T C 14: 54,591,325 T240A probably benign Het
Abca15 T C 7: 120,332,694 Y57H probably benign Het
Adgrf4 A G 17: 42,666,529 I641T possibly damaging Het
Ankrd11 A G 8: 122,889,821 Y2410H probably damaging Het
Apbb2 C A 5: 66,452,261 L14F probably null Het
Arhgdia T C 11: 120,579,235 D204G probably damaging Het
Catsperd A T 17: 56,662,736 Y610F possibly damaging Het
Cblb T A 16: 52,033,103 D27E probably damaging Het
Ccdc180 A T 4: 45,917,453 I893F probably damaging Het
Ccdc180 A G 4: 45,917,508 H911R probably damaging Het
Cdh23 T A 10: 60,307,935 I2966F probably damaging Het
Chat G A 14: 32,419,105 P445L probably damaging Het
Chdh G T 14: 30,032,852 R273L possibly damaging Het
Clic3 T C 2: 25,457,917 V72A probably benign Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Ddr1 T A 17: 35,690,130 D241V probably damaging Het
Dock7 T A 4: 99,020,077 K605N probably damaging Het
Dsg2 T A 18: 20,579,430 F164I probably damaging Het
Dstyk T A 1: 132,453,106 N446K probably damaging Het
Epb42 A T 2: 121,034,451 L53Q probably damaging Het
Extl2 G C 3: 116,027,192 K229N probably benign Het
Frmd4b T A 6: 97,298,090 S617C probably damaging Het
Fscb C T 12: 64,473,814 V293I probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm4978 A C 9: 69,450,872 probably benign Het
Gm6729 A G 10: 86,540,388 noncoding transcript Het
Gnat2 A C 3: 108,100,616 N293T probably benign Het
Herpud1 T C 8: 94,390,842 I142T probably benign Het
Irak2 G A 6: 113,693,730 V536I probably benign Het
Kcnu1 A T 8: 25,897,862 probably null Het
Kdm4a A G 4: 118,161,754 S422P probably benign Het
Lair1 T A 7: 4,028,949 D53V probably benign Het
Lhx1 G T 11: 84,519,909 Y196* probably null Het
Lrrc37a G A 11: 103,497,612 T2329I unknown Het
Mag T C 7: 30,909,200 D163G probably damaging Het
Magi3 A G 3: 104,051,392 V459A probably damaging Het
Med13 A G 11: 86,288,118 Y1451H probably damaging Het
Megf8 T A 7: 25,360,706 C2341S probably damaging Het
Mppe1 A G 18: 67,228,024 C221R probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nutm2 T C 13: 50,474,873 C658R possibly damaging Het
Olfm1 T C 2: 28,222,590 V239A possibly damaging Het
Pcnx C T 12: 81,917,793 H245Y possibly damaging Het
Pgm3 A G 9: 86,559,476 L356S probably damaging Het
Pik3r4 C G 9: 105,668,994 H207D probably benign Het
Pkd1l1 T C 11: 8,844,585 T1859A probably benign Het
Pon3 A T 6: 5,221,625 V335E possibly damaging Het
Ppp4r3b A G 11: 29,211,740 T705A probably benign Het
Prmt7 T C 8: 106,237,278 V268A probably benign Het
Psd C T 19: 46,322,417 G398R probably damaging Het
Pygl A G 12: 70,206,381 V188A probably damaging Het
Rnf13 T A 3: 57,796,206 N110K probably damaging Het
Rnf170 C T 8: 26,125,911 Q77* probably null Het
Rrp8 A T 7: 105,734,077 Y327* probably null Het
Ruvbl2 T C 7: 45,424,726 D228G probably damaging Het
Scgn T A 13: 23,989,824 T35S probably benign Het
Scyl3 C T 1: 163,934,747 P74S probably damaging Het
Sec61b T G 4: 47,483,074 S123A probably benign Het
Sertad2 T C 11: 20,647,899 S32P possibly damaging Het
Slc23a3 T C 1: 75,133,803 probably null Het
Sult2a2 T G 7: 13,738,298 V140G probably benign Het
Tbc1d4 A T 14: 101,507,231 S320T probably benign Het
Trabd2b T C 4: 114,408,944 Y52H probably damaging Het
Traf2 T C 2: 25,530,288 E183G probably null Het
Trip10 G T 17: 57,263,017 V561F possibly damaging Het
Ttc7 G T 17: 87,306,958 V184F probably benign Het
Ubc A G 5: 125,386,229 V678A probably benign Het
Unk A G 11: 116,053,665 E414G possibly damaging Het
Usp42 T C 5: 143,719,762 N365D probably damaging Het
Zbtb26 A T 2: 37,436,769 I85K probably damaging Het
Zfhx2 A T 14: 55,066,434 H1364Q possibly damaging Het
Other mutations in Mtus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mtus1 APN 8 41084349 missense probably damaging 1.00
IGL01377:Mtus1 APN 8 41083135 missense possibly damaging 0.94
IGL01472:Mtus1 APN 8 41002412 missense probably benign 0.01
IGL01995:Mtus1 APN 8 41084420 missense probably damaging 1.00
IGL02027:Mtus1 APN 8 40993601 missense probably damaging 1.00
IGL02381:Mtus1 APN 8 41083119 missense probably benign 0.05
IGL02571:Mtus1 APN 8 41083482 missense possibly damaging 0.90
IGL02936:Mtus1 APN 8 40999517 missense possibly damaging 0.79
R0116:Mtus1 UTSW 8 40998477 unclassified probably benign
R0139:Mtus1 UTSW 8 41016196 splice site probably benign
R0178:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0179:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0220:Mtus1 UTSW 8 40994572 missense probably damaging 1.00
R0324:Mtus1 UTSW 8 41084395 missense probably benign
R0355:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R0357:Mtus1 UTSW 8 41083526 missense possibly damaging 0.71
R0464:Mtus1 UTSW 8 41002474 missense probably damaging 0.96
R0681:Mtus1 UTSW 8 40993517 missense probably damaging 1.00
R1016:Mtus1 UTSW 8 41050026 missense probably benign 0.43
R1570:Mtus1 UTSW 8 41076241 missense probably damaging 1.00
R1579:Mtus1 UTSW 8 41082858 missense probably damaging 1.00
R1607:Mtus1 UTSW 8 41015409 missense possibly damaging 0.58
R1869:Mtus1 UTSW 8 41076230 critical splice donor site probably null
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1891:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1894:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R2063:Mtus1 UTSW 8 41082708 missense probably damaging 1.00
R2111:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2112:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2224:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2226:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2227:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2516:Mtus1 UTSW 8 41082739 missense probably damaging 1.00
R3414:Mtus1 UTSW 8 41048063 missense probably damaging 1.00
R3899:Mtus1 UTSW 8 41083129 missense probably benign
R4096:Mtus1 UTSW 8 41084247 missense probably damaging 0.99
R4831:Mtus1 UTSW 8 41083152 missense probably damaging 1.00
R4850:Mtus1 UTSW 8 41084470 missense possibly damaging 0.81
R4916:Mtus1 UTSW 8 41000801 missense probably damaging 1.00
R4988:Mtus1 UTSW 8 41084541 missense probably benign 0.05
R5133:Mtus1 UTSW 8 41083192 missense probably benign 0.00
R5468:Mtus1 UTSW 8 41084578 missense probably benign 0.00
R5598:Mtus1 UTSW 8 41022555 missense probably damaging 1.00
R5782:Mtus1 UTSW 8 41082727 missense probably damaging 1.00
R5860:Mtus1 UTSW 8 41076266 missense probably damaging 0.99
R5900:Mtus1 UTSW 8 41083497 missense possibly damaging 0.92
R5943:Mtus1 UTSW 8 41084265 missense probably benign 0.00
R6019:Mtus1 UTSW 8 41083040 missense probably benign 0.33
R6125:Mtus1 UTSW 8 41084539 missense probably damaging 0.99
R6197:Mtus1 UTSW 8 41084037 missense possibly damaging 0.90
R6488:Mtus1 UTSW 8 41041508 missense possibly damaging 0.52
R6869:Mtus1 UTSW 8 41082654 missense possibly damaging 0.71
R7117:Mtus1 UTSW 8 41083584 missense possibly damaging 0.95
R7126:Mtus1 UTSW 8 41015402 missense probably damaging 0.98
R7213:Mtus1 UTSW 8 41084487 missense probably damaging 0.99
R7308:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R7424:Mtus1 UTSW 8 41022406 missense probably damaging 1.00
R7481:Mtus1 UTSW 8 41084615 missense probably damaging 0.99
R7485:Mtus1 UTSW 8 41084553 missense probably benign 0.37
R7660:Mtus1 UTSW 8 41016211 missense probably benign
R7699:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7700:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7709:Mtus1 UTSW 8 41054650 missense possibly damaging 0.81
R7791:Mtus1 UTSW 8 41083380 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCATCGGTAAACACAGACAAG -3'
(R):5'- TCCCTGGAAAAGCTGCTTCC -3'

Sequencing Primer
(F):5'- TACAGCTGCCGGCACAC -3'
(R):5'- GAAAAGCTGCTTCCCCTGC -3'
Posted On2016-04-27