Mutagenetix > Incidental Mutation

Incidental Mutation 'R4940:Pkd1l1'

383019

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l1

Ensembl Gene

ENSMUSG00000046634

Gene Name

polycystic kidney disease 1 like 1

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4940 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8826708-8973266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8844585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1859 (T1859A)

Ref Sequence

ENSEMBL: ENSMUSP00000136518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178195]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000154153
AA Change: T2309A

SMART Domains

Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: T2309A

Domain	Start	End	E-Value	Type
low complexity region	172	184	N/A	INTRINSIC
PKD	205	287	2.9e0	SMART
PKD	291	369	1.42e-9	SMART
Pfam:REJ	398	1001	1.7e-45	PFAM
low complexity region	1208	1218	N/A	INTRINSIC
GPS	1370	1413	1.21e-1	SMART
transmembrane domain	1434	1451	N/A	INTRINSIC
LH2	1479	1598	2.94e-3	SMART
transmembrane domain	1640	1659	N/A	INTRINSIC
transmembrane domain	1679	1701	N/A	INTRINSIC
transmembrane domain	1817	1839	N/A	INTRINSIC
transmembrane domain	1854	1876	N/A	INTRINSIC
Pfam:PKD_channel	2109	2339	1.5e-23	PFAM
transmembrane domain	2381	2403	N/A	INTRINSIC
low complexity region	2436	2449	N/A	INTRINSIC
low complexity region	2458	2469	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155886

Predicted Effect

probably benign
Transcript: ENSMUST00000178195
AA Change: T1859A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: T1859A

Domain	Start	End	E-Value	Type
Pfam:REJ	3	552	3.3e-41	PFAM
low complexity region	757	767	N/A	INTRINSIC
Blast:GPS	919	965	2e-13	BLAST
transmembrane domain	983	1000	N/A	INTRINSIC
Pfam:PLAT	1030	1145	7.2e-14	PFAM
transmembrane domain	1189	1208	N/A	INTRINSIC
transmembrane domain	1228	1250	N/A	INTRINSIC
transmembrane domain	1366	1388	N/A	INTRINSIC
transmembrane domain	1403	1425	N/A	INTRINSIC
Pfam:PKD_channel	1658	1889	2e-25	PFAM
transmembrane domain	1930	1952	N/A	INTRINSIC
low complexity region	1985	1998	N/A	INTRINSIC
low complexity region	2007	2018	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	G	5: 98,737,636	H134R	possibly damaging	Het
3632451O06Rik	A	T	14: 49,773,482	M256K	probably benign	Het
4931414P19Rik	T	C	14: 54,591,325	T240A	probably benign	Het
Abca15	T	C	7: 120,332,694	Y57H	probably benign	Het
Adgrf4	A	G	17: 42,666,529	I641T	possibly damaging	Het
Ankrd11	A	G	8: 122,889,821	Y2410H	probably damaging	Het
Apbb2	C	A	5: 66,452,261	L14F	probably null	Het
Arhgdia	T	C	11: 120,579,235	D204G	probably damaging	Het
Catsperd	A	T	17: 56,662,736	Y610F	possibly damaging	Het
Cblb	T	A	16: 52,033,103	D27E	probably damaging	Het
Ccdc180	A	T	4: 45,917,453	I893F	probably damaging	Het
Ccdc180	A	G	4: 45,917,508	H911R	probably damaging	Het
Cdh23	T	A	10: 60,307,935	I2966F	probably damaging	Het
Chat	G	A	14: 32,419,105	P445L	probably damaging	Het
Chdh	G	T	14: 30,032,852	R273L	possibly damaging	Het
Clic3	T	C	2: 25,457,917	V72A	probably benign	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Ddr1	T	A	17: 35,690,130	D241V	probably damaging	Het
Dock7	T	A	4: 99,020,077	K605N	probably damaging	Het
Dsg2	T	A	18: 20,579,430	F164I	probably damaging	Het
Dstyk	T	A	1: 132,453,106	N446K	probably damaging	Het
Epb42	A	T	2: 121,034,451	L53Q	probably damaging	Het
Extl2	G	C	3: 116,027,192	K229N	probably benign	Het
Frmd4b	T	A	6: 97,298,090	S617C	probably damaging	Het
Fscb	C	T	12: 64,473,814	V293I	probably benign	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm4978	A	C	9: 69,450,872		probably benign	Het
Gm6729	A	G	10: 86,540,388		noncoding transcript	Het
Gnat2	A	C	3: 108,100,616	N293T	probably benign	Het
Herpud1	T	C	8: 94,390,842	I142T	probably benign	Het
Irak2	G	A	6: 113,693,730	V536I	probably benign	Het
Kcnu1	A	T	8: 25,897,862		probably null	Het
Kdm4a	A	G	4: 118,161,754	S422P	probably benign	Het
Lair1	T	A	7: 4,028,949	D53V	probably benign	Het
Lhx1	G	T	11: 84,519,909	Y196*	probably null	Het
Lrrc37a	G	A	11: 103,497,612	T2329I	unknown	Het
Mag	T	C	7: 30,909,200	D163G	probably damaging	Het
Magi3	A	G	3: 104,051,392	V459A	probably damaging	Het
Med13	A	G	11: 86,288,118	Y1451H	probably damaging	Het
Megf8	T	A	7: 25,360,706	C2341S	probably damaging	Het
Mppe1	A	G	18: 67,228,024	C221R	probably damaging	Het
Mtus1	T	A	8: 41,041,478	H39L	possibly damaging	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nutm2	T	C	13: 50,474,873	C658R	possibly damaging	Het
Olfm1	T	C	2: 28,222,590	V239A	possibly damaging	Het
Pcnx	C	T	12: 81,917,793	H245Y	possibly damaging	Het
Pgm3	A	G	9: 86,559,476	L356S	probably damaging	Het
Pik3r4	C	G	9: 105,668,994	H207D	probably benign	Het
Pon3	A	T	6: 5,221,625	V335E	possibly damaging	Het
Ppp4r3b	A	G	11: 29,211,740	T705A	probably benign	Het
Prmt7	T	C	8: 106,237,278	V268A	probably benign	Het
Psd	C	T	19: 46,322,417	G398R	probably damaging	Het
Pygl	A	G	12: 70,206,381	V188A	probably damaging	Het
Rnf13	T	A	3: 57,796,206	N110K	probably damaging	Het
Rnf170	C	T	8: 26,125,911	Q77*	probably null	Het
Rrp8	A	T	7: 105,734,077	Y327*	probably null	Het
Ruvbl2	T	C	7: 45,424,726	D228G	probably damaging	Het
Scgn	T	A	13: 23,989,824	T35S	probably benign	Het
Scyl3	C	T	1: 163,934,747	P74S	probably damaging	Het
Sec61b	T	G	4: 47,483,074	S123A	probably benign	Het
Sertad2	T	C	11: 20,647,899	S32P	possibly damaging	Het
Slc23a3	T	C	1: 75,133,803		probably null	Het
Sult2a2	T	G	7: 13,738,298	V140G	probably benign	Het
Tbc1d4	A	T	14: 101,507,231	S320T	probably benign	Het
Trabd2b	T	C	4: 114,408,944	Y52H	probably damaging	Het
Traf2	T	C	2: 25,530,288	E183G	probably null	Het
Trip10	G	T	17: 57,263,017	V561F	possibly damaging	Het
Ttc7	G	T	17: 87,306,958	V184F	probably benign	Het
Ubc	A	G	5: 125,386,229	V678A	probably benign	Het
Unk	A	G	11: 116,053,665	E414G	possibly damaging	Het
Usp42	T	C	5: 143,719,762	N365D	probably damaging	Het
Zbtb26	A	T	2: 37,436,769	I85K	probably damaging	Het
Zfhx2	A	T	14: 55,066,434	H1364Q	possibly damaging	Het

Other mutations in Pkd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pkd1l1	APN	11	8961971	missense	unknown
IGL00156:Pkd1l1	APN	11	8950515	missense	probably damaging	1.00
IGL00161:Pkd1l1	APN	11	8929353	critical splice donor site	probably null
IGL00489:Pkd1l1	APN	11	8834773	critical splice donor site	probably null
IGL00495:Pkd1l1	APN	11	8868493	missense	probably benign	0.34
IGL00983:Pkd1l1	APN	11	8844585	missense	probably benign
IGL01071:Pkd1l1	APN	11	8848921	missense	probably benign	0.00
IGL01093:Pkd1l1	APN	11	8901345	missense	probably benign	0.06
IGL01295:Pkd1l1	APN	11	8933685	missense	possibly damaging	0.93
IGL01311:Pkd1l1	APN	11	8901174	missense	possibly damaging	0.53
IGL01412:Pkd1l1	APN	11	8950409	missense	possibly damaging	0.73
IGL01978:Pkd1l1	APN	11	8961336	missense	unknown
IGL01999:Pkd1l1	APN	11	8836291	missense	probably benign
IGL02080:Pkd1l1	APN	11	8961345	missense	unknown
IGL02106:Pkd1l1	APN	11	8833800	missense	probably damaging	1.00
IGL02216:Pkd1l1	APN	11	8834897	missense	probably damaging	0.96
IGL02305:Pkd1l1	APN	11	8902467	missense	probably benign
IGL02337:Pkd1l1	APN	11	8942079	missense	probably damaging	1.00
IGL02576:Pkd1l1	APN	11	8844560	missense	possibly damaging	0.61
IGL02704:Pkd1l1	APN	11	8834910	missense	probably benign	0.00
IGL02814:Pkd1l1	APN	11	8902582	missense	probably benign	0.01
IGL02904:Pkd1l1	APN	11	8868450	splice site	probably benign
IGL02972:Pkd1l1	APN	11	8863908	missense	probably damaging	0.99
IGL03091:Pkd1l1	APN	11	8855564	missense	probably damaging	1.00
IGL03113:Pkd1l1	APN	11	8834793	missense	probably benign	0.20
IGL03210:Pkd1l1	APN	11	8965127	missense	unknown
PIT4581001:Pkd1l1	UTSW	11	8916298	frame shift	probably null
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0496:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
R0547:Pkd1l1	UTSW	11	8836448	splice site	probably benign
R0582:Pkd1l1	UTSW	11	8931699	splice site	probably benign
R0761:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R0969:Pkd1l1	UTSW	11	8936898	missense	probably damaging	1.00
R1348:Pkd1l1	UTSW	11	8834806	missense	probably benign	0.18
R1366:Pkd1l1	UTSW	11	8941038	splice site	probably benign
R1401:Pkd1l1	UTSW	11	8854487	nonsense	probably null
R1444:Pkd1l1	UTSW	11	8854386	missense	probably damaging	1.00
R1445:Pkd1l1	UTSW	11	8870313	missense	probably benign	0.00
R1463:Pkd1l1	UTSW	11	8916302	missense	probably damaging	1.00
R1496:Pkd1l1	UTSW	11	8941077	missense	possibly damaging	0.95
R1542:Pkd1l1	UTSW	11	8874179	missense	possibly damaging	0.82
R1543:Pkd1l1	UTSW	11	8901200	missense	probably damaging	1.00
R1619:Pkd1l1	UTSW	11	8950413	missense	probably damaging	0.98
R1875:Pkd1l1	UTSW	11	8844670	splice site	probably benign
R1929:Pkd1l1	UTSW	11	8836197	splice site	probably benign
R1958:Pkd1l1	UTSW	11	8874161	missense	probably benign	0.01
R2223:Pkd1l1	UTSW	11	8889063	missense	probably benign	0.18
R2223:Pkd1l1	UTSW	11	8950422	missense	probably benign
R2264:Pkd1l1	UTSW	11	8879112	missense	probably damaging	0.97
R2349:Pkd1l1	UTSW	11	8826819	splice site	probably null
R2431:Pkd1l1	UTSW	11	8947197	missense	probably damaging	0.99
R2483:Pkd1l1	UTSW	11	8962701	missense	probably damaging	1.00
R2517:Pkd1l1	UTSW	11	8958900	missense	unknown
R2888:Pkd1l1	UTSW	11	8947251	missense	probably damaging	1.00
R2965:Pkd1l1	UTSW	11	8874236	missense	probably damaging	1.00
R3123:Pkd1l1	UTSW	11	8973021	missense	unknown
R3153:Pkd1l1	UTSW	11	8867207	missense	probably benign	0.01
R3840:Pkd1l1	UTSW	11	8889050	missense	probably damaging	1.00
R3855:Pkd1l1	UTSW	11	8965047	critical splice donor site	probably null
R3880:Pkd1l1	UTSW	11	8961983	missense	unknown
R3970:Pkd1l1	UTSW	11	8874218	missense	probably damaging	1.00
R4195:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4196:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4246:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4247:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4249:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4250:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4593:Pkd1l1	UTSW	11	8901253	missense	probably damaging	0.97
R4609:Pkd1l1	UTSW	11	8958964	missense	unknown
R4797:Pkd1l1	UTSW	11	8961340	missense	unknown
R4910:Pkd1l1	UTSW	11	8929360	missense	possibly damaging	0.50
R5084:Pkd1l1	UTSW	11	8942004	missense	probably benign	0.05
R5147:Pkd1l1	UTSW	11	8849003	missense	possibly damaging	0.71
R5360:Pkd1l1	UTSW	11	8879204	missense	probably benign
R5483:Pkd1l1	UTSW	11	8901141	critical splice donor site	probably null
R5604:Pkd1l1	UTSW	11	8833877	missense	probably damaging	0.98
R5642:Pkd1l1	UTSW	11	8879202	missense	probably damaging	1.00
R5652:Pkd1l1	UTSW	11	8909889	missense	probably benign	0.03
R5751:Pkd1l1	UTSW	11	8867204	missense	possibly damaging	0.45
R5761:Pkd1l1	UTSW	11	8916301	missense	probably damaging	1.00
R5800:Pkd1l1	UTSW	11	8861302	missense	probably benign
R5874:Pkd1l1	UTSW	11	8908688	missense	probably damaging	1.00
R5897:Pkd1l1	UTSW	11	8879176	missense	probably benign	0.03
R5913:Pkd1l1	UTSW	11	8863849	missense	probably benign	0.00
R5930:Pkd1l1	UTSW	11	8958969	missense	unknown
R6000:Pkd1l1	UTSW	11	8950427	missense	probably benign	0.00
R6005:Pkd1l1	UTSW	11	8857113	missense	probably damaging	1.00
R6013:Pkd1l1	UTSW	11	8869452	splice site	probably null
R6027:Pkd1l1	UTSW	11	8916272	nonsense	probably null
R6028:Pkd1l1	UTSW	11	8836267	missense	probably benign	0.06
R6129:Pkd1l1	UTSW	11	8868543	missense	probably benign	0.00
R6182:Pkd1l1	UTSW	11	8865555	missense	probably benign	0.36
R6226:Pkd1l1	UTSW	11	8901287	missense	probably benign	0.00
R6257:Pkd1l1	UTSW	11	8942195	missense	probably benign	0.22
R6340:Pkd1l1	UTSW	11	8844649	missense	probably benign	0.09
R6478:Pkd1l1	UTSW	11	8863911	missense	probably benign	0.00
R6558:Pkd1l1	UTSW	11	8889052	missense	probably benign	0.00
R6750:Pkd1l1	UTSW	11	8973217	missense	unknown
R6987:Pkd1l1	UTSW	11	8902575	missense	probably benign	0.01
R6996:Pkd1l1	UTSW	11	8849046	missense	probably damaging	1.00
R7139:Pkd1l1	UTSW	11	8890737	missense
R7224:Pkd1l1	UTSW	11	8945241	missense
R7244:Pkd1l1	UTSW	11	8871771	missense
R7265:Pkd1l1	UTSW	11	8929402	missense
R7358:Pkd1l1	UTSW	11	8945202	missense
R7387:Pkd1l1	UTSW	11	8901203	missense
R7414:Pkd1l1	UTSW	11	8916267	missense
R7459:Pkd1l1	UTSW	11	8902428	missense
R7478:Pkd1l1	UTSW	11	8929441	missense
R7485:Pkd1l1	UTSW	11	8965148	missense
R7490:Pkd1l1	UTSW	11	8916265	missense
R7644:Pkd1l1	UTSW	11	8875758	missense
R7647:Pkd1l1	UTSW	11	8947296	missense
R7676:Pkd1l1	UTSW	11	8962708	missense
R7687:Pkd1l1	UTSW	11	8854390	missense
R7699:Pkd1l1	UTSW	11	8965142	missense
R7922:Pkd1l1	UTSW	11	8849013	missense
R7922:Pkd1l1	UTSW	11	8909857	missense
R7980:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R7993:Pkd1l1	UTSW	11	8945262	missense
R8052:Pkd1l1	UTSW	11	8947315	missense
R8125:Pkd1l1	UTSW	11	8947241	missense	probably damaging	1.00
R8420:Pkd1l1	UTSW	11	8870277	nonsense	probably null
R8675:Pkd1l1	UTSW	11	8848916	critical splice donor site	probably null
R8683:Pkd1l1	UTSW	11	8871805	missense
R8709:Pkd1l1	UTSW	11	8855567	missense
R8711:Pkd1l1	UTSW	11	8865550	missense
R8725:Pkd1l1	UTSW	11	8961482	missense
R8733:Pkd1l1	UTSW	11	8933657	missense
R8822:Pkd1l1	UTSW	11	8856312	missense
R8871:Pkd1l1	UTSW	11	8950503	missense
R9009:Pkd1l1	UTSW	11	8931552	missense
R9099:Pkd1l1	UTSW	11	8972986	missense
R9119:Pkd1l1	UTSW	11	8879107	missense
R9150:Pkd1l1	UTSW	11	8836256	missense
R9314:Pkd1l1	UTSW	11	8879153	missense
R9341:Pkd1l1	UTSW	11	8836399	missense
R9341:Pkd1l1	UTSW	11	8961305	missense
R9343:Pkd1l1	UTSW	11	8836399	missense
R9343:Pkd1l1	UTSW	11	8961305	missense
R9392:Pkd1l1	UTSW	11	8844567	missense
R9424:Pkd1l1	UTSW	11	8870091	missense
R9496:Pkd1l1	UTSW	11	8833773	critical splice donor site	probably null
R9504:Pkd1l1	UTSW	11	8865631	missense
R9563:Pkd1l1	UTSW	11	8865502	missense
R9570:Pkd1l1	UTSW	11	8890697	missense
R9585:Pkd1l1	UTSW	11	8854390	missense
R9618:Pkd1l1	UTSW	11	8961420	missense
R9709:Pkd1l1	UTSW	11	8849016	missense	probably damaging	0.98
R9741:Pkd1l1	UTSW	11	8947224	missense
R9801:Pkd1l1	UTSW	11	8958964	nonsense	probably null
X0024:Pkd1l1	UTSW	11	8950413	missense	probably benign	0.01
X0063:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
X0065:Pkd1l1	UTSW	11	8909921	missense	probably benign	0.10
Z1176:Pkd1l1	UTSW	11	8826801	missense
Z1177:Pkd1l1	UTSW	11	8945208	missense

Predicted Primers

PCR Primer
(F):5'- AATTCGGAGGCTAGAATTGGC -3'
(R):5'- ACACTGTCACTTGGTGTCCC -3'

Sequencing Primer
(F):5'- AATTGGCAATGGTGTGTGACCC -3'
(R):5'- GGATACCTGTGGTCTGAACAATTCC -3'

Posted On

2016-04-27