Incidental Mutation 'R4940:Glp2r'
ID383022
Institutional Source Beutler Lab
Gene Symbol Glp2r
Ensembl Gene ENSMUSG00000049928
Gene Nameglucagon-like peptide 2 receptor
SynonymsGLP-2, 9530092J08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4940 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67661502-67771153 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 67757593 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 94 (Y94*)
Ref Sequence ENSEMBL: ENSMUSP00000061560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000051765]
Predicted Effect probably benign
Transcript: ENSMUST00000021289
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000051765
AA Change: Y94*
SMART Domains Protein: ENSMUSP00000061560
Gene: ENSMUSG00000049928
AA Change: Y94*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:HRM 53 122 3.4e-16 PFAM
Pfam:7tm_2 137 394 1.5e-79 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null mutation display defects in Paneth cell physiology, increased small bowel bacterial loads, and increased susceptibility to small bowel injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,737,636 H134R possibly damaging Het
3632451O06Rik A T 14: 49,773,482 M256K probably benign Het
4931414P19Rik T C 14: 54,591,325 T240A probably benign Het
Abca15 T C 7: 120,332,694 Y57H probably benign Het
Adgrf4 A G 17: 42,666,529 I641T possibly damaging Het
Ankrd11 A G 8: 122,889,821 Y2410H probably damaging Het
Apbb2 C A 5: 66,452,261 L14F probably null Het
Arhgdia T C 11: 120,579,235 D204G probably damaging Het
Catsperd A T 17: 56,662,736 Y610F possibly damaging Het
Cblb T A 16: 52,033,103 D27E probably damaging Het
Ccdc180 A T 4: 45,917,453 I893F probably damaging Het
Ccdc180 A G 4: 45,917,508 H911R probably damaging Het
Cdh23 T A 10: 60,307,935 I2966F probably damaging Het
Chat G A 14: 32,419,105 P445L probably damaging Het
Chdh G T 14: 30,032,852 R273L possibly damaging Het
Clic3 T C 2: 25,457,917 V72A probably benign Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Ddr1 T A 17: 35,690,130 D241V probably damaging Het
Dock7 T A 4: 99,020,077 K605N probably damaging Het
Dsg2 T A 18: 20,579,430 F164I probably damaging Het
Dstyk T A 1: 132,453,106 N446K probably damaging Het
Epb42 A T 2: 121,034,451 L53Q probably damaging Het
Extl2 G C 3: 116,027,192 K229N probably benign Het
Frmd4b T A 6: 97,298,090 S617C probably damaging Het
Fscb C T 12: 64,473,814 V293I probably benign Het
Gm4978 A C 9: 69,450,872 probably benign Het
Gm6729 A G 10: 86,540,388 noncoding transcript Het
Gnat2 A C 3: 108,100,616 N293T probably benign Het
Herpud1 T C 8: 94,390,842 I142T probably benign Het
Irak2 G A 6: 113,693,730 V536I probably benign Het
Kcnu1 A T 8: 25,897,862 probably null Het
Kdm4a A G 4: 118,161,754 S422P probably benign Het
Lair1 T A 7: 4,028,949 D53V probably benign Het
Lhx1 G T 11: 84,519,909 Y196* probably null Het
Lrrc37a G A 11: 103,497,612 T2329I unknown Het
Mag T C 7: 30,909,200 D163G probably damaging Het
Magi3 A G 3: 104,051,392 V459A probably damaging Het
Med13 A G 11: 86,288,118 Y1451H probably damaging Het
Megf8 T A 7: 25,360,706 C2341S probably damaging Het
Mppe1 A G 18: 67,228,024 C221R probably damaging Het
Mtus1 T A 8: 41,041,478 H39L possibly damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nutm2 T C 13: 50,474,873 C658R possibly damaging Het
Olfm1 T C 2: 28,222,590 V239A possibly damaging Het
Pcnx C T 12: 81,917,793 H245Y possibly damaging Het
Pgm3 A G 9: 86,559,476 L356S probably damaging Het
Pik3r4 C G 9: 105,668,994 H207D probably benign Het
Pkd1l1 T C 11: 8,844,585 T1859A probably benign Het
Pon3 A T 6: 5,221,625 V335E possibly damaging Het
Ppp4r3b A G 11: 29,211,740 T705A probably benign Het
Prmt7 T C 8: 106,237,278 V268A probably benign Het
Psd C T 19: 46,322,417 G398R probably damaging Het
Pygl A G 12: 70,206,381 V188A probably damaging Het
Rnf13 T A 3: 57,796,206 N110K probably damaging Het
Rnf170 C T 8: 26,125,911 Q77* probably null Het
Rrp8 A T 7: 105,734,077 Y327* probably null Het
Ruvbl2 T C 7: 45,424,726 D228G probably damaging Het
Scgn T A 13: 23,989,824 T35S probably benign Het
Scyl3 C T 1: 163,934,747 P74S probably damaging Het
Sec61b T G 4: 47,483,074 S123A probably benign Het
Sertad2 T C 11: 20,647,899 S32P possibly damaging Het
Slc23a3 T C 1: 75,133,803 probably null Het
Sult2a2 T G 7: 13,738,298 V140G probably benign Het
Tbc1d4 A T 14: 101,507,231 S320T probably benign Het
Trabd2b T C 4: 114,408,944 Y52H probably damaging Het
Traf2 T C 2: 25,530,288 E183G probably null Het
Trip10 G T 17: 57,263,017 V561F possibly damaging Het
Ttc7 G T 17: 87,306,958 V184F probably benign Het
Ubc A G 5: 125,386,229 V678A probably benign Het
Unk A G 11: 116,053,665 E414G possibly damaging Het
Usp42 T C 5: 143,719,762 N365D probably damaging Het
Zbtb26 A T 2: 37,436,769 I85K probably damaging Het
Zfhx2 A T 14: 55,066,434 H1364Q possibly damaging Het
Other mutations in Glp2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Glp2r APN 11 67709644 missense probably benign
IGL02244:Glp2r APN 11 67721991 missense probably damaging 1.00
IGL02484:Glp2r APN 11 67740166 missense possibly damaging 0.90
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0195:Glp2r UTSW 11 67709708 missense probably damaging 0.99
R1612:Glp2r UTSW 11 67742207 missense possibly damaging 0.46
R1699:Glp2r UTSW 11 67757541 missense probably benign 0.09
R1944:Glp2r UTSW 11 67746792 missense probably benign 0.01
R3971:Glp2r UTSW 11 67746815 missense possibly damaging 0.65
R4417:Glp2r UTSW 11 67664516 intron probably benign
R4681:Glp2r UTSW 11 67730627 splice site probably null
R4914:Glp2r UTSW 11 67757593 nonsense probably null
R4918:Glp2r UTSW 11 67757593 nonsense probably null
R4938:Glp2r UTSW 11 67757593 nonsense probably null
R4941:Glp2r UTSW 11 67746703 splice site probably null
R4963:Glp2r UTSW 11 67757593 nonsense probably null
R4966:Glp2r UTSW 11 67757593 nonsense probably null
R5023:Glp2r UTSW 11 67741032 missense possibly damaging 0.82
R5121:Glp2r UTSW 11 67722100 splice site probably null
R5313:Glp2r UTSW 11 67757531 missense probably damaging 0.96
R5705:Glp2r UTSW 11 67709739 missense probably benign 0.30
R5790:Glp2r UTSW 11 67764799 missense probably damaging 1.00
R6074:Glp2r UTSW 11 67746814 missense unknown
R6595:Glp2r UTSW 11 67764777 missense probably benign 0.10
R6910:Glp2r UTSW 11 67730671 missense probably benign 0.28
R7511:Glp2r UTSW 11 67757591 missense probably damaging 0.98
R7627:Glp2r UTSW 11 67746763 missense unknown
R7681:Glp2r UTSW 11 67709679 missense probably benign 0.45
R7779:Glp2r UTSW 11 67709783 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTGCTGGTGGAAGGTCTC -3'
(R):5'- GTTTCTTCCCATCCCAAATAAACAG -3'

Sequencing Primer
(F):5'- AAGGTCTCGTGTCCCCCTAAAG -3'
(R):5'- TCCCAAATAAACAGTAGGGATGC -3'
Posted On2016-04-27