Mutagenetix > Incidental Mutation

Incidental Mutation 'R4940:Pygl'

383029

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R4940 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70206381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 188 (V188A)

Ref Sequence

ENSEMBL: ENSMUSP00000125585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably damaging
Transcript: ENSMUST00000071250
AA Change: V279A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: V279A

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000161083
AA Change: V188A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: V188A

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161840

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222093

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	G	5: 98,737,636	H134R	possibly damaging	Het
3632451O06Rik	A	T	14: 49,773,482	M256K	probably benign	Het
4931414P19Rik	T	C	14: 54,591,325	T240A	probably benign	Het
Abca15	T	C	7: 120,332,694	Y57H	probably benign	Het
Adgrf4	A	G	17: 42,666,529	I641T	possibly damaging	Het
Ankrd11	A	G	8: 122,889,821	Y2410H	probably damaging	Het
Apbb2	C	A	5: 66,452,261	L14F	probably null	Het
Arhgdia	T	C	11: 120,579,235	D204G	probably damaging	Het
Catsperd	A	T	17: 56,662,736	Y610F	possibly damaging	Het
Cblb	T	A	16: 52,033,103	D27E	probably damaging	Het
Ccdc180	A	T	4: 45,917,453	I893F	probably damaging	Het
Ccdc180	A	G	4: 45,917,508	H911R	probably damaging	Het
Cdh23	T	A	10: 60,307,935	I2966F	probably damaging	Het
Chat	G	A	14: 32,419,105	P445L	probably damaging	Het
Chdh	G	T	14: 30,032,852	R273L	possibly damaging	Het
Clic3	T	C	2: 25,457,917	V72A	probably benign	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Ddr1	T	A	17: 35,690,130	D241V	probably damaging	Het
Dock7	T	A	4: 99,020,077	K605N	probably damaging	Het
Dsg2	T	A	18: 20,579,430	F164I	probably damaging	Het
Dstyk	T	A	1: 132,453,106	N446K	probably damaging	Het
Epb42	A	T	2: 121,034,451	L53Q	probably damaging	Het
Extl2	G	C	3: 116,027,192	K229N	probably benign	Het
Frmd4b	T	A	6: 97,298,090	S617C	probably damaging	Het
Fscb	C	T	12: 64,473,814	V293I	probably benign	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm4978	A	C	9: 69,450,872		probably benign	Het
Gm6729	A	G	10: 86,540,388		noncoding transcript	Het
Gnat2	A	C	3: 108,100,616	N293T	probably benign	Het
Herpud1	T	C	8: 94,390,842	I142T	probably benign	Het
Irak2	G	A	6: 113,693,730	V536I	probably benign	Het
Kcnu1	A	T	8: 25,897,862		probably null	Het
Kdm4a	A	G	4: 118,161,754	S422P	probably benign	Het
Lair1	T	A	7: 4,028,949	D53V	probably benign	Het
Lhx1	G	T	11: 84,519,909	Y196*	probably null	Het
Lrrc37a	G	A	11: 103,497,612	T2329I	unknown	Het
Mag	T	C	7: 30,909,200	D163G	probably damaging	Het
Magi3	A	G	3: 104,051,392	V459A	probably damaging	Het
Med13	A	G	11: 86,288,118	Y1451H	probably damaging	Het
Megf8	T	A	7: 25,360,706	C2341S	probably damaging	Het
Mppe1	A	G	18: 67,228,024	C221R	probably damaging	Het
Mtus1	T	A	8: 41,041,478	H39L	possibly damaging	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nutm2	T	C	13: 50,474,873	C658R	possibly damaging	Het
Olfm1	T	C	2: 28,222,590	V239A	possibly damaging	Het
Pcnx	C	T	12: 81,917,793	H245Y	possibly damaging	Het
Pgm3	A	G	9: 86,559,476	L356S	probably damaging	Het
Pik3r4	C	G	9: 105,668,994	H207D	probably benign	Het
Pkd1l1	T	C	11: 8,844,585	T1859A	probably benign	Het
Pon3	A	T	6: 5,221,625	V335E	possibly damaging	Het
Ppp4r3b	A	G	11: 29,211,740	T705A	probably benign	Het
Prmt7	T	C	8: 106,237,278	V268A	probably benign	Het
Psd	C	T	19: 46,322,417	G398R	probably damaging	Het
Rnf13	T	A	3: 57,796,206	N110K	probably damaging	Het
Rnf170	C	T	8: 26,125,911	Q77*	probably null	Het
Rrp8	A	T	7: 105,734,077	Y327*	probably null	Het
Ruvbl2	T	C	7: 45,424,726	D228G	probably damaging	Het
Scgn	T	A	13: 23,989,824	T35S	probably benign	Het
Scyl3	C	T	1: 163,934,747	P74S	probably damaging	Het
Sec61b	T	G	4: 47,483,074	S123A	probably benign	Het
Sertad2	T	C	11: 20,647,899	S32P	possibly damaging	Het
Slc23a3	T	C	1: 75,133,803		probably null	Het
Sult2a2	T	G	7: 13,738,298	V140G	probably benign	Het
Tbc1d4	A	T	14: 101,507,231	S320T	probably benign	Het
Trabd2b	T	C	4: 114,408,944	Y52H	probably damaging	Het
Traf2	T	C	2: 25,530,288	E183G	probably null	Het
Trip10	G	T	17: 57,263,017	V561F	possibly damaging	Het
Ttc7	G	T	17: 87,306,958	V184F	probably benign	Het
Ubc	A	G	5: 125,386,229	V678A	probably benign	Het
Unk	A	G	11: 116,053,665	E414G	possibly damaging	Het
Usp42	T	C	5: 143,719,762	N365D	probably damaging	Het
Zbtb26	A	T	2: 37,436,769	I85K	probably damaging	Het
Zfhx2	A	T	14: 55,066,434	H1364Q	possibly damaging	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CCACCAGTTTGATCTCATGAATTGTAC -3'
(R):5'- CTAGCATTGAACTCTCCTGGG -3'

Sequencing Primer
(F):5'- ACAAGTTTGTTTTCCTTACTTGACGG -3'
(R):5'- CTAGCATTGAACTCTCCTGGGAAGAG -3'

Posted On

2016-04-27