Incidental Mutation 'R4940:Cyp2d12'
ID383041
Institutional Source Beutler Lab
Gene Symbol Cyp2d12
Ensembl Gene ENSMUSG00000096852
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 12
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4940 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82555072-82560403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82558050 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 244 (D244E)
Ref Sequence ENSEMBL: ENSMUSP00000154856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068861] [ENSMUST00000228974] [ENSMUST00000229103] [ENSMUST00000229904]
Predicted Effect probably benign
Transcript: ENSMUST00000068861
AA Change: D295E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071064
Gene: ENSMUSG00000096852
AA Change: D295E

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 37 497 3.6e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184191
Predicted Effect probably benign
Transcript: ENSMUST00000228974
Predicted Effect probably benign
Transcript: ENSMUST00000229103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229792
Predicted Effect probably benign
Transcript: ENSMUST00000229904
AA Change: D244E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230859
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,737,636 H134R possibly damaging Het
3632451O06Rik A T 14: 49,773,482 M256K probably benign Het
4931414P19Rik T C 14: 54,591,325 T240A probably benign Het
Abca15 T C 7: 120,332,694 Y57H probably benign Het
Adgrf4 A G 17: 42,666,529 I641T possibly damaging Het
Ankrd11 A G 8: 122,889,821 Y2410H probably damaging Het
Apbb2 C A 5: 66,452,261 L14F probably null Het
Arhgdia T C 11: 120,579,235 D204G probably damaging Het
Catsperd A T 17: 56,662,736 Y610F possibly damaging Het
Cblb T A 16: 52,033,103 D27E probably damaging Het
Ccdc180 A T 4: 45,917,453 I893F probably damaging Het
Ccdc180 A G 4: 45,917,508 H911R probably damaging Het
Cdh23 T A 10: 60,307,935 I2966F probably damaging Het
Chat G A 14: 32,419,105 P445L probably damaging Het
Chdh G T 14: 30,032,852 R273L possibly damaging Het
Clic3 T C 2: 25,457,917 V72A probably benign Het
Ddr1 T A 17: 35,690,130 D241V probably damaging Het
Dock7 T A 4: 99,020,077 K605N probably damaging Het
Dsg2 T A 18: 20,579,430 F164I probably damaging Het
Dstyk T A 1: 132,453,106 N446K probably damaging Het
Epb42 A T 2: 121,034,451 L53Q probably damaging Het
Extl2 G C 3: 116,027,192 K229N probably benign Het
Frmd4b T A 6: 97,298,090 S617C probably damaging Het
Fscb C T 12: 64,473,814 V293I probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm4978 A C 9: 69,450,872 probably benign Het
Gm6729 A G 10: 86,540,388 noncoding transcript Het
Gnat2 A C 3: 108,100,616 N293T probably benign Het
Herpud1 T C 8: 94,390,842 I142T probably benign Het
Irak2 G A 6: 113,693,730 V536I probably benign Het
Kcnu1 A T 8: 25,897,862 probably null Het
Kdm4a A G 4: 118,161,754 S422P probably benign Het
Lair1 T A 7: 4,028,949 D53V probably benign Het
Lhx1 G T 11: 84,519,909 Y196* probably null Het
Lrrc37a G A 11: 103,497,612 T2329I unknown Het
Mag T C 7: 30,909,200 D163G probably damaging Het
Magi3 A G 3: 104,051,392 V459A probably damaging Het
Med13 A G 11: 86,288,118 Y1451H probably damaging Het
Megf8 T A 7: 25,360,706 C2341S probably damaging Het
Mppe1 A G 18: 67,228,024 C221R probably damaging Het
Mtus1 T A 8: 41,041,478 H39L possibly damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nutm2 T C 13: 50,474,873 C658R possibly damaging Het
Olfm1 T C 2: 28,222,590 V239A possibly damaging Het
Pcnx C T 12: 81,917,793 H245Y possibly damaging Het
Pgm3 A G 9: 86,559,476 L356S probably damaging Het
Pik3r4 C G 9: 105,668,994 H207D probably benign Het
Pkd1l1 T C 11: 8,844,585 T1859A probably benign Het
Pon3 A T 6: 5,221,625 V335E possibly damaging Het
Ppp4r3b A G 11: 29,211,740 T705A probably benign Het
Prmt7 T C 8: 106,237,278 V268A probably benign Het
Psd C T 19: 46,322,417 G398R probably damaging Het
Pygl A G 12: 70,206,381 V188A probably damaging Het
Rnf13 T A 3: 57,796,206 N110K probably damaging Het
Rnf170 C T 8: 26,125,911 Q77* probably null Het
Rrp8 A T 7: 105,734,077 Y327* probably null Het
Ruvbl2 T C 7: 45,424,726 D228G probably damaging Het
Scgn T A 13: 23,989,824 T35S probably benign Het
Scyl3 C T 1: 163,934,747 P74S probably damaging Het
Sec61b T G 4: 47,483,074 S123A probably benign Het
Sertad2 T C 11: 20,647,899 S32P possibly damaging Het
Slc23a3 T C 1: 75,133,803 probably null Het
Sult2a2 T G 7: 13,738,298 V140G probably benign Het
Tbc1d4 A T 14: 101,507,231 S320T probably benign Het
Trabd2b T C 4: 114,408,944 Y52H probably damaging Het
Traf2 T C 2: 25,530,288 E183G probably null Het
Trip10 G T 17: 57,263,017 V561F possibly damaging Het
Ttc7 G T 17: 87,306,958 V184F probably benign Het
Ubc A G 5: 125,386,229 V678A probably benign Het
Unk A G 11: 116,053,665 E414G possibly damaging Het
Usp42 T C 5: 143,719,762 N365D probably damaging Het
Zbtb26 A T 2: 37,436,769 I85K probably damaging Het
Zfhx2 A T 14: 55,066,434 H1364Q possibly damaging Het
Other mutations in Cyp2d12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Cyp2d12 APN 15 82555344 splice site probably benign
IGL02318:Cyp2d12 APN 15 82555243 missense probably benign 0.33
IGL02353:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02360:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02491:Cyp2d12 APN 15 82558481 missense possibly damaging 0.88
IGL02651:Cyp2d12 APN 15 82556740 missense probably damaging 0.99
IGL02664:Cyp2d12 APN 15 82559334 missense probably benign
IGL03169:Cyp2d12 APN 15 82559291 missense probably benign 0.00
IGL03354:Cyp2d12 APN 15 82558961 missense probably damaging 1.00
PIT4581001:Cyp2d12 UTSW 15 82558451 missense probably damaging 1.00
R0426:Cyp2d12 UTSW 15 82558963 missense probably benign 0.12
R0578:Cyp2d12 UTSW 15 82556383 splice site probably benign
R1297:Cyp2d12 UTSW 15 82557686 missense probably benign 0.31
R1517:Cyp2d12 UTSW 15 82558136 missense probably damaging 1.00
R1718:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R1829:Cyp2d12 UTSW 15 82558056 missense possibly damaging 0.87
R2208:Cyp2d12 UTSW 15 82556936 missense probably damaging 1.00
R2366:Cyp2d12 UTSW 15 82555154 missense probably damaging 1.00
R2385:Cyp2d12 UTSW 15 82558495 missense probably benign 0.00
R2504:Cyp2d12 UTSW 15 82559036 missense probably benign 0.06
R4009:Cyp2d12 UTSW 15 82556292 missense probably damaging 1.00
R5237:Cyp2d12 UTSW 15 82558006 splice site probably null
R5327:Cyp2d12 UTSW 15 82555222 missense probably benign 0.00
R5549:Cyp2d12 UTSW 15 82556297 missense probably benign 0.23
R6128:Cyp2d12 UTSW 15 82558965 missense probably benign
R6275:Cyp2d12 UTSW 15 82556658 missense probably benign 0.00
R6723:Cyp2d12 UTSW 15 82556884 missense probably benign
R6808:Cyp2d12 UTSW 15 82556733 missense probably damaging 1.00
R6947:Cyp2d12 UTSW 15 82559047 missense probably benign
R7137:Cyp2d12 UTSW 15 82557821 missense probably benign 0.42
R7224:Cyp2d12 UTSW 15 82557648 splice site probably null
R7513:Cyp2d12 UTSW 15 82558420 missense probably benign
R7698:Cyp2d12 UTSW 15 82558970 missense probably benign 0.02
X0065:Cyp2d12 UTSW 15 82557828 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGTCCTATGAGCTGTGAGGCC -3'
(R):5'- GGCCATGTCAGAAACACCAG -3'

Sequencing Primer
(F):5'- CCTATGAGCTGTGAGGCCAGATG -3'
(R):5'- GGTAGCACTGGTAGCCACAATC -3'
Posted On2016-04-27