Incidental Mutation 'R4941:Ppox'
ID383054
Institutional Source Beutler Lab
Gene Symbol Ppox
Ensembl Gene ENSMUSG00000062729
Gene Nameprotoporphyrinogen oxidase
Synonyms
MMRRC Submission 042539-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R4941 (G1)
Quality Score171
Status Validated
Chromosome1
Chromosomal Location171275990-171281186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171277593 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 341 (M341V)
Ref Sequence ENSEMBL: ENSMUSP00000141835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000065941] [ENSMUST00000073120] [ENSMUST00000111305] [ENSMUST00000111306] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141114] [ENSMUST00000192956] [ENSMUST00000151863] [ENSMUST00000149187]
Predicted Effect probably benign
Transcript: ENSMUST00000064272
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065941
SMART Domains Protein: ENSMUSP00000064002
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073120
AA Change: M368V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729
AA Change: M368V

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111305
SMART Domains Protein: ENSMUSP00000106936
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111306
SMART Domains Protein: ENSMUSP00000106938
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 559 4.1e-60 PFAM
Pfam:UCH_1 215 541 3.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111313
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126699
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133050
Predicted Effect probably benign
Transcript: ENSMUST00000141114
SMART Domains Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:Glyco_transf_7N 104 139 2.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192956
AA Change: M341V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729
AA Change: M341V

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144393
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Predicted Effect probably benign
Transcript: ENSMUST00000149187
SMART Domains Protein: ENSMUSP00000120161
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 438 1e-36 PFAM
Pfam:UCH_1 212 436 2.1e-10 PFAM
Meta Mutation Damage Score 0.8294 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for the R59W knock-in mutation exhibit elevated stool porphyrin levels and reduced hepatic protoporphyrinogen oxidase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,917,702 H528P probably damaging Het
4932438A13Rik G A 3: 36,919,901 S600N probably benign Het
A4galt T A 15: 83,228,328 I85F probably damaging Het
Abcc6 T A 7: 46,012,523 I435F probably benign Het
Adam3 T C 8: 24,677,316 probably benign Het
Adrb3 T C 8: 27,227,422 Y333C probably damaging Het
Ago4 A T 4: 126,526,054 D43E probably benign Het
Agt T A 8: 124,556,988 Q464L probably benign Het
Amdhd1 A T 10: 93,531,601 D230E probably damaging Het
Aplf A G 6: 87,668,423 I33T probably damaging Het
Aplf A T 6: 87,646,349 N249K probably benign Het
Arap2 A G 5: 62,749,478 M66T probably benign Het
Atf4 T C 15: 80,256,233 probably benign Het
AU019823 G T 9: 50,607,509 Q268K probably benign Het
Bahcc1 A C 11: 120,286,665 H2068P probably benign Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Catsper1 C A 19: 5,341,438 A616D possibly damaging Het
Ccdc94 A G 17: 55,964,149 D97G possibly damaging Het
Cdkn3 A G 14: 46,769,863 D159G possibly damaging Het
Cep162 T C 9: 87,225,969 probably benign Het
Clca1 T A 3: 145,015,653 I386L probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cmtm3 T C 8: 104,343,828 L73P probably damaging Het
Cnksr3 A C 10: 7,152,925 L149R probably benign Het
Cope T C 8: 70,302,934 probably null Het
Cpa6 T A 1: 10,409,337 M224L probably benign Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Ddx55 T A 5: 124,568,716 L592* probably null Het
Deup1 T C 9: 15,588,027 M333V probably benign Het
Eif4a1 T C 11: 69,667,814 probably benign Het
Eif4g3 A C 4: 138,170,565 D1026A probably damaging Het
Eif5b T C 1: 38,051,199 V1153A probably damaging Het
Ercc8 G T 13: 108,160,767 probably benign Het
Fam227a C A 15: 79,640,003 probably null Het
Fat1 A G 8: 45,036,275 I3505V probably benign Het
Fat3 T G 9: 16,375,152 E1025A probably damaging Het
Fat4 C T 3: 38,957,452 R2234W probably damaging Het
Fer1l4 G T 2: 156,045,089 F634L probably damaging Het
Fetub G A 16: 22,937,874 V162I probably benign Het
Fgd4 T C 16: 16,484,538 Q51R probably benign Het
Fgfr2 T C 7: 130,198,445 H140R probably benign Het
Flt3 T A 5: 147,356,375 probably null Het
Gabrb1 A G 5: 72,136,778 N465S probably damaging Het
Gapdhs T C 7: 30,733,266 I206V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Glp2r T C 11: 67,746,703 probably null Het
Gm4956 T A 1: 21,298,082 noncoding transcript Het
Gtf2a1l A T 17: 88,714,922 D447V probably damaging Het
Hsd3b5 A G 3: 98,619,063 W356R probably damaging Het
Idh2 A T 7: 80,096,099 V335D probably damaging Het
Isyna1 T C 8: 70,595,496 I184T probably damaging Het
Kcnh2 A G 5: 24,331,087 S320P probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kpna6 A G 4: 129,648,032 F524S probably damaging Het
Lap3 A T 5: 45,506,197 M338L probably benign Het
Lins1 T C 7: 66,709,450 probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc43 A G 5: 123,501,063 D385G probably benign Het
Maf T C 8: 115,706,793 D24G unknown Het
Nell1 T C 7: 50,062,638 S69P probably benign Het
Olfr1342 C T 4: 118,689,892 V187I possibly damaging Het
Olfr1436 A G 19: 12,298,896 S79P possibly damaging Het
Olfr531 T A 7: 140,400,879 M56L probably benign Het
Olfr609 T C 7: 103,492,251 D209G probably damaging Het
Olfr91 C T 17: 37,093,592 G94E probably damaging Het
Olfr969 T C 9: 39,795,864 M163T possibly damaging Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Parp14 T C 16: 35,846,033 N1210S probably benign Het
Pcdhb10 C A 18: 37,412,834 T321K probably benign Het
Pcdhb8 C T 18: 37,356,006 L246F probably benign Het
Pcdhga1 T A 18: 37,662,606 I221K probably benign Het
Pcdhga9 T A 18: 37,738,132 V338E probably damaging Het
Pdcd11 T C 19: 47,119,886 S1231P probably damaging Het
Pde6c A T 19: 38,151,565 L325F probably damaging Het
Pnpla7 T A 2: 24,997,264 probably null Het
Pparg T A 6: 115,490,110 V478E probably damaging Het
Ppib T C 9: 66,060,390 V42A probably benign Het
Proc T C 18: 32,125,113 K260E possibly damaging Het
Ptpro C T 6: 137,392,765 P525L probably damaging Het
Rnf14 C A 18: 38,308,382 A275E probably damaging Het
Scnn1b C T 7: 121,912,008 P306L probably damaging Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc26a5 A G 5: 21,820,386 I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 Y438C probably damaging Het
Spire1 T C 18: 67,519,314 E231G possibly damaging Het
Stab1 T A 14: 31,151,571 I1014F probably benign Het
Steap2 T C 5: 5,677,651 Y228C probably damaging Het
Tmem131l T C 3: 83,899,239 T1487A probably benign Het
Tmem171 A G 13: 98,692,295 F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 V199A probably damaging Het
Tmem45a T C 16: 56,822,289 N173S possibly damaging Het
Uqcrc2 C T 7: 120,643,078 R148C probably benign Het
Vmn2r116 A G 17: 23,401,142 K617E probably damaging Het
Xrcc6 T C 15: 82,039,812 L229P probably damaging Het
Zfp184 A G 13: 21,949,721 D46G probably damaging Het
Zfp790 T A 7: 29,829,491 C534S possibly damaging Het
Zfp990 A T 4: 145,536,837 N135I probably damaging Het
Other mutations in Ppox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Ppox APN 1 171277880 critical splice donor site probably null
IGL01818:Ppox APN 1 171280744 missense probably benign 0.29
IGL01899:Ppox APN 1 171277082 missense probably benign 0.00
IGL01931:Ppox APN 1 171277883 missense probably null 0.51
IGL02802:Ppox UTSW 1 171277493 nonsense probably null
R0131:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0131:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0132:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0184:Ppox UTSW 1 171279552 missense probably damaging 1.00
R0426:Ppox UTSW 1 171277749 missense probably damaging 1.00
R0542:Ppox UTSW 1 171279244 missense probably damaging 1.00
R0615:Ppox UTSW 1 171277814 splice site probably benign
R1559:Ppox UTSW 1 171280006 intron probably benign
R3687:Ppox UTSW 1 171277493 missense probably damaging 1.00
R5037:Ppox UTSW 1 171277596 missense probably damaging 1.00
R5599:Ppox UTSW 1 171277460 missense probably damaging 1.00
R5739:Ppox UTSW 1 171279996 missense probably damaging 1.00
R5791:Ppox UTSW 1 171277312 missense probably damaging 1.00
R5892:Ppox UTSW 1 171277461 missense probably damaging 0.98
R7564:Ppox UTSW 1 171280191 missense probably benign 0.14
R7937:Ppox UTSW 1 171279972 missense possibly damaging 0.93
R7949:Ppox UTSW 1 171277948 missense probably benign 0.00
Z1177:Ppox UTSW 1 171280498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGCCTGTCGTCACTTC -3'
(R):5'- TGGTGCCATCGTCAGAAGAC -3'

Sequencing Primer
(F):5'- ACTTCCAGGGCTTTCAGCG -3'
(R):5'- TCAGAAGACCCGACTGTCCTG -3'
Posted On2016-04-27