Incidental Mutation 'R4941:Eif4g3'
ID383070
Institutional Source Beutler Lab
Gene Symbol Eif4g3
Ensembl Gene ENSMUSG00000028760
Gene Nameeukaryotic translation initiation factor 4 gamma, 3
Synonyms1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII
MMRRC Submission 042539-MU
Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R4941 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137993022-138208508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 138170565 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1026 (D1026A)
Ref Sequence ENSEMBL: ENSMUSP00000145147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084214
AA Change: D861A

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760
AA Change: D861A

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 147 152 N/A INTRINSIC
PDB:1LJ2|D 154 179 8e-9 PDB
low complexity region 192 207 N/A INTRINSIC
low complexity region 269 310 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 592 616 N/A INTRINSIC
Blast:MIF4G 617 708 5e-49 BLAST
Blast:MIF4G 722 765 5e-16 BLAST
MIF4G 768 996 1.42e-65 SMART
low complexity region 1086 1109 N/A INTRINSIC
MA3 1215 1327 9.29e-38 SMART
eIF5C 1487 1574 7.92e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084215
AA Change: D843A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760
AA Change: D843A

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 75 102 N/A INTRINSIC
low complexity region 129 134 N/A INTRINSIC
PDB:1LJ2|D 136 161 8e-9 PDB
low complexity region 174 189 N/A INTRINSIC
low complexity region 251 292 N/A INTRINSIC
low complexity region 409 426 N/A INTRINSIC
low complexity region 516 532 N/A INTRINSIC
low complexity region 561 570 N/A INTRINSIC
low complexity region 574 598 N/A INTRINSIC
Blast:MIF4G 599 690 4e-49 BLAST
Blast:MIF4G 704 747 5e-16 BLAST
MIF4G 750 978 1.42e-65 SMART
low complexity region 1068 1113 N/A INTRINSIC
MA3 1216 1328 9.29e-38 SMART
eIF5C 1488 1575 7.92e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105831
AA Change: D850A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760
AA Change: D850A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
low complexity region 82 109 N/A INTRINSIC
low complexity region 136 141 N/A INTRINSIC
PDB:1LJ2|D 143 168 8e-9 PDB
low complexity region 181 196 N/A INTRINSIC
low complexity region 258 299 N/A INTRINSIC
low complexity region 416 433 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
low complexity region 581 605 N/A INTRINSIC
Blast:MIF4G 606 697 4e-49 BLAST
Blast:MIF4G 711 754 5e-16 BLAST
MIF4G 757 985 1.42e-65 SMART
low complexity region 1075 1098 N/A INTRINSIC
MA3 1204 1316 9.29e-38 SMART
eIF5C 1476 1563 7.92e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140796
AA Change: D285A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760
AA Change: D285A

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 16 40 N/A INTRINSIC
Blast:MIF4G 41 132 2e-49 BLAST
Blast:MIF4G 146 189 3e-16 BLAST
MIF4G 192 420 1.42e-65 SMART
low complexity region 510 533 N/A INTRINSIC
MA3 639 751 9.29e-38 SMART
eIF5C 911 998 7.92e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203828
AA Change: D1026A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760
AA Change: D1026A

DomainStartEndE-ValueType
low complexity region 41 81 N/A INTRINSIC
low complexity region 193 208 N/A INTRINSIC
low complexity region 258 285 N/A INTRINSIC
low complexity region 312 317 N/A INTRINSIC
PDB:1LJ2|D 319 344 9e-9 PDB
low complexity region 357 372 N/A INTRINSIC
low complexity region 434 475 N/A INTRINSIC
low complexity region 592 609 N/A INTRINSIC
low complexity region 699 715 N/A INTRINSIC
low complexity region 744 753 N/A INTRINSIC
low complexity region 757 781 N/A INTRINSIC
Blast:MIF4G 782 873 9e-49 BLAST
Blast:MIF4G 887 930 5e-16 BLAST
MIF4G 933 1161 6e-68 SMART
coiled coil region 1174 1201 N/A INTRINSIC
low complexity region 1251 1296 N/A INTRINSIC
MA3 1399 1511 3.9e-40 SMART
eIF5C 1671 1758 3.9e-38 SMART
Meta Mutation Damage Score 0.2097 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,917,702 H528P probably damaging Het
4932438A13Rik G A 3: 36,919,901 S600N probably benign Het
A4galt T A 15: 83,228,328 I85F probably damaging Het
Abcc6 T A 7: 46,012,523 I435F probably benign Het
Adam3 T C 8: 24,677,316 probably benign Het
Adrb3 T C 8: 27,227,422 Y333C probably damaging Het
Ago4 A T 4: 126,526,054 D43E probably benign Het
Agt T A 8: 124,556,988 Q464L probably benign Het
Amdhd1 A T 10: 93,531,601 D230E probably damaging Het
Aplf A G 6: 87,668,423 I33T probably damaging Het
Aplf A T 6: 87,646,349 N249K probably benign Het
Arap2 A G 5: 62,749,478 M66T probably benign Het
Atf4 T C 15: 80,256,233 probably benign Het
AU019823 G T 9: 50,607,509 Q268K probably benign Het
Bahcc1 A C 11: 120,286,665 H2068P probably benign Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Catsper1 C A 19: 5,341,438 A616D possibly damaging Het
Ccdc94 A G 17: 55,964,149 D97G possibly damaging Het
Cdkn3 A G 14: 46,769,863 D159G possibly damaging Het
Cep162 T C 9: 87,225,969 probably benign Het
Clca1 T A 3: 145,015,653 I386L probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cmtm3 T C 8: 104,343,828 L73P probably damaging Het
Cnksr3 A C 10: 7,152,925 L149R probably benign Het
Cope T C 8: 70,302,934 probably null Het
Cpa6 T A 1: 10,409,337 M224L probably benign Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Ddx55 T A 5: 124,568,716 L592* probably null Het
Deup1 T C 9: 15,588,027 M333V probably benign Het
Eif4a1 T C 11: 69,667,814 probably benign Het
Eif5b T C 1: 38,051,199 V1153A probably damaging Het
Ercc8 G T 13: 108,160,767 probably benign Het
Fam227a C A 15: 79,640,003 probably null Het
Fat1 A G 8: 45,036,275 I3505V probably benign Het
Fat3 T G 9: 16,375,152 E1025A probably damaging Het
Fat4 C T 3: 38,957,452 R2234W probably damaging Het
Fer1l4 G T 2: 156,045,089 F634L probably damaging Het
Fetub G A 16: 22,937,874 V162I probably benign Het
Fgd4 T C 16: 16,484,538 Q51R probably benign Het
Fgfr2 T C 7: 130,198,445 H140R probably benign Het
Flt3 T A 5: 147,356,375 probably null Het
Gabrb1 A G 5: 72,136,778 N465S probably damaging Het
Gapdhs T C 7: 30,733,266 I206V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Glp2r T C 11: 67,746,703 probably null Het
Gm4956 T A 1: 21,298,082 noncoding transcript Het
Gtf2a1l A T 17: 88,714,922 D447V probably damaging Het
Hsd3b5 A G 3: 98,619,063 W356R probably damaging Het
Idh2 A T 7: 80,096,099 V335D probably damaging Het
Isyna1 T C 8: 70,595,496 I184T probably damaging Het
Kcnh2 A G 5: 24,331,087 S320P probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kpna6 A G 4: 129,648,032 F524S probably damaging Het
Lap3 A T 5: 45,506,197 M338L probably benign Het
Lins1 T C 7: 66,709,450 probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc43 A G 5: 123,501,063 D385G probably benign Het
Maf T C 8: 115,706,793 D24G unknown Het
Nell1 T C 7: 50,062,638 S69P probably benign Het
Olfr1342 C T 4: 118,689,892 V187I possibly damaging Het
Olfr1436 A G 19: 12,298,896 S79P possibly damaging Het
Olfr531 T A 7: 140,400,879 M56L probably benign Het
Olfr609 T C 7: 103,492,251 D209G probably damaging Het
Olfr91 C T 17: 37,093,592 G94E probably damaging Het
Olfr969 T C 9: 39,795,864 M163T possibly damaging Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Parp14 T C 16: 35,846,033 N1210S probably benign Het
Pcdhb10 C A 18: 37,412,834 T321K probably benign Het
Pcdhb8 C T 18: 37,356,006 L246F probably benign Het
Pcdhga1 T A 18: 37,662,606 I221K probably benign Het
Pcdhga9 T A 18: 37,738,132 V338E probably damaging Het
Pdcd11 T C 19: 47,119,886 S1231P probably damaging Het
Pde6c A T 19: 38,151,565 L325F probably damaging Het
Pnpla7 T A 2: 24,997,264 probably null Het
Pparg T A 6: 115,490,110 V478E probably damaging Het
Ppib T C 9: 66,060,390 V42A probably benign Het
Ppox T C 1: 171,277,593 M341V probably damaging Het
Proc T C 18: 32,125,113 K260E possibly damaging Het
Ptpro C T 6: 137,392,765 P525L probably damaging Het
Rnf14 C A 18: 38,308,382 A275E probably damaging Het
Scnn1b C T 7: 121,912,008 P306L probably damaging Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc26a5 A G 5: 21,820,386 I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 Y438C probably damaging Het
Spire1 T C 18: 67,519,314 E231G possibly damaging Het
Stab1 T A 14: 31,151,571 I1014F probably benign Het
Steap2 T C 5: 5,677,651 Y228C probably damaging Het
Tmem131l T C 3: 83,899,239 T1487A probably benign Het
Tmem171 A G 13: 98,692,295 F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 V199A probably damaging Het
Tmem45a T C 16: 56,822,289 N173S possibly damaging Het
Uqcrc2 C T 7: 120,643,078 R148C probably benign Het
Vmn2r116 A G 17: 23,401,142 K617E probably damaging Het
Xrcc6 T C 15: 82,039,812 L229P probably damaging Het
Zfp184 A G 13: 21,949,721 D46G probably damaging Het
Zfp790 T A 7: 29,829,491 C534S possibly damaging Het
Zfp990 A T 4: 145,536,837 N135I probably damaging Het
Other mutations in Eif4g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Eif4g3 APN 4 138120362 missense probably benign 0.01
IGL02171:Eif4g3 APN 4 138126589 missense probably benign 0.03
IGL02487:Eif4g3 APN 4 138203378 missense possibly damaging 0.92
IGL02514:Eif4g3 APN 4 138126194 missense possibly damaging 0.87
IGL02622:Eif4g3 APN 4 138097366 splice site probably benign
IGL02725:Eif4g3 APN 4 138170471 splice site probably benign
IGL02735:Eif4g3 APN 4 138126211 missense probably benign 0.40
IGL03008:Eif4g3 APN 4 138120388 missense probably damaging 1.00
IGL03077:Eif4g3 APN 4 138125855 missense probably damaging 1.00
N/A - 535:Eif4g3 UTSW 4 138120428 missense probably damaging 0.98
R0013:Eif4g3 UTSW 4 138175848 missense possibly damaging 0.88
R0193:Eif4g3 UTSW 4 138146376 splice site probably benign
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0563:Eif4g3 UTSW 4 138175840 splice site probably benign
R0841:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R0884:Eif4g3 UTSW 4 138151776 missense possibly damaging 0.76
R1116:Eif4g3 UTSW 4 138091775 critical splice donor site probably null
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1192:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R1401:Eif4g3 UTSW 4 138206084 missense probably damaging 0.99
R1535:Eif4g3 UTSW 4 138097302 missense probably damaging 1.00
R1571:Eif4g3 UTSW 4 138120408 missense probably damaging 1.00
R1576:Eif4g3 UTSW 4 138096870 missense probably damaging 0.99
R1607:Eif4g3 UTSW 4 138126563 missense probably benign 0.00
R1618:Eif4g3 UTSW 4 138206058 missense probably damaging 1.00
R1793:Eif4g3 UTSW 4 138171131 missense probably damaging 1.00
R1823:Eif4g3 UTSW 4 138180491 missense probably benign 0.37
R1857:Eif4g3 UTSW 4 138175876 missense possibly damaging 0.67
R1907:Eif4g3 UTSW 4 138158415 missense probably damaging 1.00
R2041:Eif4g3 UTSW 4 138105306 splice site probably benign
R2106:Eif4g3 UTSW 4 138082919 start gained probably benign
R2124:Eif4g3 UTSW 4 138184742 missense probably damaging 1.00
R2301:Eif4g3 UTSW 4 138172659 missense probably damaging 1.00
R2519:Eif4g3 UTSW 4 138097318 missense probably benign 0.37
R3033:Eif4g3 UTSW 4 138103410 missense probably damaging 1.00
R3870:Eif4g3 UTSW 4 138096900 missense probably damaging 0.98
R4542:Eif4g3 UTSW 4 138203417 missense probably damaging 0.99
R4582:Eif4g3 UTSW 4 138171245 missense probably damaging 1.00
R4607:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4608:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4658:Eif4g3 UTSW 4 138206132 missense probably damaging 1.00
R4736:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4739:Eif4g3 UTSW 4 138183199 missense possibly damaging 0.79
R4739:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4740:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4760:Eif4g3 UTSW 4 138084318 missense possibly damaging 0.46
R4825:Eif4g3 UTSW 4 138194081 missense probably benign
R4826:Eif4g3 UTSW 4 138177945 missense possibly damaging 0.95
R5040:Eif4g3 UTSW 4 138096889 missense probably damaging 0.99
R5070:Eif4g3 UTSW 4 138146299 missense probably benign 0.00
R5155:Eif4g3 UTSW 4 138126743 missense probably benign 0.36
R5226:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5229:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5303:Eif4g3 UTSW 4 138126562 missense probably benign 0.04
R5369:Eif4g3 UTSW 4 138183334 missense possibly damaging 0.87
R5394:Eif4g3 UTSW 4 138103398 splice site probably null
R5665:Eif4g3 UTSW 4 138126589 missense probably benign 0.03
R5678:Eif4g3 UTSW 4 138151742 missense probably damaging 0.99
R5695:Eif4g3 UTSW 4 138163433 splice site probably null
R5704:Eif4g3 UTSW 4 138190692 missense probably damaging 1.00
R5924:Eif4g3 UTSW 4 138201926 missense probably damaging 1.00
R6214:Eif4g3 UTSW 4 138058003 missense probably damaging 0.99
R6278:Eif4g3 UTSW 4 138188083 missense possibly damaging 0.82
R6519:Eif4g3 UTSW 4 137994008 missense probably benign
R6659:Eif4g3 UTSW 4 138177932 missense probably damaging 1.00
R6720:Eif4g3 UTSW 4 138175832 splice site probably null
R6812:Eif4g3 UTSW 4 138103376 missense probably damaging 1.00
R6922:Eif4g3 UTSW 4 138097335 missense probably damaging 1.00
R7175:Eif4g3 UTSW 4 138126215 missense probably damaging 1.00
R7176:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R7598:Eif4g3 UTSW 4 138194124 missense probably benign 0.02
R7618:Eif4g3 UTSW 4 138171118 missense probably damaging 1.00
R7805:Eif4g3 UTSW 4 138146354 missense probably benign 0.00
R7935:Eif4g3 UTSW 4 138096771 missense probably damaging 1.00
R7983:Eif4g3 UTSW 4 138151593 missense probably benign 0.00
R8261:Eif4g3 UTSW 4 138171118 missense possibly damaging 0.46
R8371:Eif4g3 UTSW 4 138096845 missense probably damaging 1.00
R8499:Eif4g3 UTSW 4 138165928 missense probably damaging 1.00
R8670:Eif4g3 UTSW 4 138158512 critical splice donor site probably null
R8672:Eif4g3 UTSW 4 138126512 missense possibly damaging 0.75
R8744:Eif4g3 UTSW 4 137994061 small deletion probably benign
R8767:Eif4g3 UTSW 4 138203468 missense probably damaging 0.99
R8771:Eif4g3 UTSW 4 138180537 nonsense probably null
RF008:Eif4g3 UTSW 4 138175924 missense probably damaging 0.98
X0067:Eif4g3 UTSW 4 138163619 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACTGTGTGAAAGACTCAGC -3'
(R):5'- GTGACTGCCTCTAACATAGGAC -3'

Sequencing Primer
(F):5'- CACTGTGTGAAAGACTCAGCTATGTG -3'
(R):5'- TGACTGCCTCTAACATAGGACTAAAG -3'
Posted On2016-04-27