Incidental Mutation 'R4941:Kcnh2'
ID383074
Institutional Source Beutler Lab
Gene Symbol Kcnh2
Ensembl Gene ENSMUSG00000038319
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 2
Synonymsmerg1a, M-erg, Lqt2, ERG1, ether a go-go related, merg1b, LQT
MMRRC Submission 042539-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R4941 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24319589-24351604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24331087 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 320 (S320P)
Ref Sequence ENSEMBL: ENSMUSP00000047705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036092] [ENSMUST00000115098]
Predicted Effect probably damaging
Transcript: ENSMUST00000036092
AA Change: S320P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047705
Gene: ENSMUSG00000038319
AA Change: S320P

DomainStartEndE-ValueType
PAS 13 87 9.54e0 SMART
PAC 93 135 1.31e-5 SMART
low complexity region 194 199 N/A INTRINSIC
Pfam:Ion_trans 409 673 7.8e-38 PFAM
Pfam:Ion_trans_2 600 667 3.2e-13 PFAM
cNMP 744 862 1.15e-24 SMART
low complexity region 885 896 N/A INTRINSIC
low complexity region 925 956 N/A INTRINSIC
low complexity region 965 982 N/A INTRINSIC
coiled coil region 1035 1069 N/A INTRINSIC
low complexity region 1082 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115098
SMART Domains Protein: ENSMUSP00000110750
Gene: ENSMUSG00000038319

DomainStartEndE-ValueType
Pfam:Ion_trans 114 319 1.4e-22 PFAM
Pfam:Ion_trans_2 257 325 2.9e-14 PFAM
cNMP 402 520 1.15e-24 SMART
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 623 640 N/A INTRINSIC
coiled coil region 693 727 N/A INTRINSIC
low complexity region 740 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144193
Meta Mutation Damage Score 0.3944 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice which maintain expression of the A isoform and lack expression of the B isoform are predisposed to episodic sinus bradycardia. Mice with mutations causing defects in both isoforms are embryonic lethal with defects in cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,917,702 H528P probably damaging Het
4932438A13Rik G A 3: 36,919,901 S600N probably benign Het
A4galt T A 15: 83,228,328 I85F probably damaging Het
Abcc6 T A 7: 46,012,523 I435F probably benign Het
Adam3 T C 8: 24,677,316 probably benign Het
Adrb3 T C 8: 27,227,422 Y333C probably damaging Het
Ago4 A T 4: 126,526,054 D43E probably benign Het
Agt T A 8: 124,556,988 Q464L probably benign Het
Amdhd1 A T 10: 93,531,601 D230E probably damaging Het
Aplf A G 6: 87,668,423 I33T probably damaging Het
Aplf A T 6: 87,646,349 N249K probably benign Het
Arap2 A G 5: 62,749,478 M66T probably benign Het
Atf4 T C 15: 80,256,233 probably benign Het
AU019823 G T 9: 50,607,509 Q268K probably benign Het
Bahcc1 A C 11: 120,286,665 H2068P probably benign Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Catsper1 C A 19: 5,341,438 A616D possibly damaging Het
Ccdc94 A G 17: 55,964,149 D97G possibly damaging Het
Cdkn3 A G 14: 46,769,863 D159G possibly damaging Het
Cep162 T C 9: 87,225,969 probably benign Het
Clca1 T A 3: 145,015,653 I386L probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cmtm3 T C 8: 104,343,828 L73P probably damaging Het
Cnksr3 A C 10: 7,152,925 L149R probably benign Het
Cope T C 8: 70,302,934 probably null Het
Cpa6 T A 1: 10,409,337 M224L probably benign Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Ddx55 T A 5: 124,568,716 L592* probably null Het
Deup1 T C 9: 15,588,027 M333V probably benign Het
Eif4a1 T C 11: 69,667,814 probably benign Het
Eif4g3 A C 4: 138,170,565 D1026A probably damaging Het
Eif5b T C 1: 38,051,199 V1153A probably damaging Het
Ercc8 G T 13: 108,160,767 probably benign Het
Fam227a C A 15: 79,640,003 probably null Het
Fat1 A G 8: 45,036,275 I3505V probably benign Het
Fat3 T G 9: 16,375,152 E1025A probably damaging Het
Fat4 C T 3: 38,957,452 R2234W probably damaging Het
Fer1l4 G T 2: 156,045,089 F634L probably damaging Het
Fetub G A 16: 22,937,874 V162I probably benign Het
Fgd4 T C 16: 16,484,538 Q51R probably benign Het
Fgfr2 T C 7: 130,198,445 H140R probably benign Het
Flt3 T A 5: 147,356,375 probably null Het
Gabrb1 A G 5: 72,136,778 N465S probably damaging Het
Gapdhs T C 7: 30,733,266 I206V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Glp2r T C 11: 67,746,703 probably null Het
Gm4956 T A 1: 21,298,082 noncoding transcript Het
Gtf2a1l A T 17: 88,714,922 D447V probably damaging Het
Hsd3b5 A G 3: 98,619,063 W356R probably damaging Het
Idh2 A T 7: 80,096,099 V335D probably damaging Het
Isyna1 T C 8: 70,595,496 I184T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kpna6 A G 4: 129,648,032 F524S probably damaging Het
Lap3 A T 5: 45,506,197 M338L probably benign Het
Lins1 T C 7: 66,709,450 probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc43 A G 5: 123,501,063 D385G probably benign Het
Maf T C 8: 115,706,793 D24G unknown Het
Nell1 T C 7: 50,062,638 S69P probably benign Het
Olfr1342 C T 4: 118,689,892 V187I possibly damaging Het
Olfr1436 A G 19: 12,298,896 S79P possibly damaging Het
Olfr531 T A 7: 140,400,879 M56L probably benign Het
Olfr609 T C 7: 103,492,251 D209G probably damaging Het
Olfr91 C T 17: 37,093,592 G94E probably damaging Het
Olfr969 T C 9: 39,795,864 M163T possibly damaging Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Parp14 T C 16: 35,846,033 N1210S probably benign Het
Pcdhb10 C A 18: 37,412,834 T321K probably benign Het
Pcdhb8 C T 18: 37,356,006 L246F probably benign Het
Pcdhga1 T A 18: 37,662,606 I221K probably benign Het
Pcdhga9 T A 18: 37,738,132 V338E probably damaging Het
Pdcd11 T C 19: 47,119,886 S1231P probably damaging Het
Pde6c A T 19: 38,151,565 L325F probably damaging Het
Pnpla7 T A 2: 24,997,264 probably null Het
Pparg T A 6: 115,490,110 V478E probably damaging Het
Ppib T C 9: 66,060,390 V42A probably benign Het
Ppox T C 1: 171,277,593 M341V probably damaging Het
Proc T C 18: 32,125,113 K260E possibly damaging Het
Ptpro C T 6: 137,392,765 P525L probably damaging Het
Rnf14 C A 18: 38,308,382 A275E probably damaging Het
Scnn1b C T 7: 121,912,008 P306L probably damaging Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc26a5 A G 5: 21,820,386 I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 Y438C probably damaging Het
Spire1 T C 18: 67,519,314 E231G possibly damaging Het
Stab1 T A 14: 31,151,571 I1014F probably benign Het
Steap2 T C 5: 5,677,651 Y228C probably damaging Het
Tmem131l T C 3: 83,899,239 T1487A probably benign Het
Tmem171 A G 13: 98,692,295 F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 V199A probably damaging Het
Tmem45a T C 16: 56,822,289 N173S possibly damaging Het
Uqcrc2 C T 7: 120,643,078 R148C probably benign Het
Vmn2r116 A G 17: 23,401,142 K617E probably damaging Het
Xrcc6 T C 15: 82,039,812 L229P probably damaging Het
Zfp184 A G 13: 21,949,721 D46G probably damaging Het
Zfp790 T A 7: 29,829,491 C534S possibly damaging Het
Zfp990 A T 4: 145,536,837 N135I probably damaging Het
Other mutations in Kcnh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnh2 APN 5 24324966 missense probably damaging 1.00
IGL01536:Kcnh2 APN 5 24326524 missense probably damaging 1.00
IGL02305:Kcnh2 APN 5 24322660 missense possibly damaging 0.86
IGL02379:Kcnh2 APN 5 24326638 missense probably damaging 1.00
IGL03100:Kcnh2 APN 5 24322684 missense probably damaging 1.00
IGL03326:Kcnh2 APN 5 24326413 missense probably damaging 1.00
R0077:Kcnh2 UTSW 5 24322702 missense probably benign 0.11
R0349:Kcnh2 UTSW 5 24351237 missense probably benign 0.18
R0959:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R0960:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R0963:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1130:Kcnh2 UTSW 5 24331825 nonsense probably null
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1201:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1346:Kcnh2 UTSW 5 24322660 missense possibly damaging 0.86
R1608:Kcnh2 UTSW 5 24322219 missense probably benign
R1613:Kcnh2 UTSW 5 24322762 splice site probably benign
R1797:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R2006:Kcnh2 UTSW 5 24326570 missense probably damaging 1.00
R2312:Kcnh2 UTSW 5 24324954 critical splice donor site probably null
R2435:Kcnh2 UTSW 5 24326347 critical splice donor site probably null
R4623:Kcnh2 UTSW 5 24348442 missense probably benign 0.00
R5394:Kcnh2 UTSW 5 24332041 missense probably benign
R5467:Kcnh2 UTSW 5 24326767 nonsense probably null
R6127:Kcnh2 UTSW 5 24325003 missense probably damaging 1.00
R6135:Kcnh2 UTSW 5 24321793 missense probably damaging 1.00
R6280:Kcnh2 UTSW 5 24331923 missense probably benign 0.43
R6936:Kcnh2 UTSW 5 24324339 missense probably damaging 1.00
R7061:Kcnh2 UTSW 5 24331922 missense probably benign 0.01
R7136:Kcnh2 UTSW 5 24332991 missense probably benign 0.13
R7399:Kcnh2 UTSW 5 24322059 missense probably damaging 0.99
R7479:Kcnh2 UTSW 5 24325492 critical splice donor site probably null
R7860:Kcnh2 UTSW 5 24324563 missense probably damaging 1.00
R7950:Kcnh2 UTSW 5 24333036 missense probably benign 0.31
R8018:Kcnh2 UTSW 5 24320016 missense probably damaging 0.98
R8063:Kcnh2 UTSW 5 24321672 missense probably benign 0.20
R8517:Kcnh2 UTSW 5 24326638 missense probably damaging 1.00
R8681:Kcnh2 UTSW 5 24331983 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTTGAACACCTACCTGGG -3'
(R):5'- ATGTTTCCTTAAAACCCAGAGAGG -3'

Sequencing Primer
(F):5'- GACCTTCTCGGTGACATT -3'
(R):5'- TTCCTTAAAACCCAGAGAGGTCTTGC -3'
Posted On2016-04-27