Mutagenetix > Incidental Mutations

Incidental Mutation 'R0320:3425401B19Rik'

38308

Institutional Source

Beutler Lab

Gene Symbol

3425401B19Rik

Ensembl Gene

ENSMUSG00000071540

Gene Name

RIKEN cDNA 3425401B19 gene

Synonyms

MMRRC Submission

038530-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R0320 (G1)

Quality Score

216

Status

Validated

Chromosome

Chromosomal Location

32659119-32685293 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32662614 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 465 (T465A)

Ref Sequence

ENSEMBL: ENSMUSP00000093741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096038]

Predicted Effect

probably benign
Transcript: ENSMUST00000096038
AA Change: T465A

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: T465A

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
low complexity region	162	175	N/A	INTRINSIC
low complexity region	386	399	N/A	INTRINSIC
low complexity region	587	602	N/A	INTRINSIC
low complexity region	605	624	N/A	INTRINSIC
low complexity region	728	744	N/A	INTRINSIC
low complexity region	1002	1015	N/A	INTRINSIC
low complexity region	1086	1097	N/A	INTRINSIC
low complexity region	1147	1158	N/A	INTRINSIC
low complexity region	1161	1176	N/A	INTRINSIC
Pfam:DUF4585	1251	1322	6.5e-30	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

100% (71/71)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430007A20Rik	A	T	4: 144,522,420	H119L	probably damaging	Het
A430110L20Rik	T	G	1: 181,227,422		noncoding transcript	Het
Abcb10	C	T	8: 123,963,007	R439Q	probably benign	Het
Abcb8	T	C	5: 24,400,790	S199P	probably damaging	Het
Adam8	C	A	7: 139,986,442	C556F	probably damaging	Het
Akap11	T	C	14: 78,513,379	T523A	probably benign	Het
Aldh3b1	T	C	19: 3,918,999		probably benign	Het
Arhgap30	T	A	1: 171,403,804	W230R	possibly damaging	Het
Atp8b4	A	G	2: 126,459,694	I82T	possibly damaging	Het
Bptf	A	T	11: 107,072,819	L1850I	probably damaging	Het
C4b	C	A	17: 34,733,161	V1237L	probably benign	Het
Calu	C	A	6: 29,374,551		probably benign	Het
Ccdc129	T	C	6: 55,976,447	I916T	probably damaging	Het
Cit	C	A	5: 115,979,445	L1227M	possibly damaging	Het
Col4a1	C	T	8: 11,242,782		probably null	Het
Cp	T	C	3: 19,974,848		probably benign	Het
Cpd	T	C	11: 76,840,447	D311G	possibly damaging	Het
Ctc1	T	A	11: 69,033,537	S972T	probably damaging	Het
Dnah17	A	G	11: 118,052,674	F3201L	possibly damaging	Het
Dopey2	C	A	16: 93,810,147	R2113S	probably benign	Het
Dym	T	A	18: 75,199,262	D520E	probably damaging	Het
Eif5a	G	T	11: 69,917,479	T64K	probably benign	Het
Flt3	A	T	5: 147,369,579		probably benign	Het
Ints6	A	T	14: 62,707,635	Y415*	probably null	Het
Itga1	A	G	13: 114,977,594		probably benign	Het
Itgae	A	G	11: 73,130,999	H902R	possibly damaging	Het
Kdm5a	T	C	6: 120,389,620	I406T	probably benign	Het
Lmx1a	C	T	1: 167,791,404	Q111*	probably null	Het
Lrrc25	T	C	8: 70,618,246	Y226H	probably benign	Het
Mcam	T	A	9: 44,140,186	N447K	possibly damaging	Het
Mcm10	A	T	2: 5,004,086	D357E	probably benign	Het
Nrip1	T	C	16: 76,292,363	T769A	probably benign	Het
Ofcc1	G	C	13: 40,206,696	Q286E	probably benign	Het
Olfr382	T	G	11: 73,516,924	I92L	probably damaging	Het
Olfr689	A	T	7: 105,314,654	I217F	probably benign	Het
Parp3	T	A	9: 106,475,812	N55I	possibly damaging	Het
Parp4	T	C	14: 56,588,496		probably null	Het
Pilrb1	G	A	5: 137,854,998	T181I	probably benign	Het
Ppm1n	A	G	7: 19,278,356	V317A	probably damaging	Het
Prdm2	A	T	4: 143,179,351	F55L	probably damaging	Het
Psd2	C	T	18: 35,979,644	R131C	probably damaging	Het
Ralgps1	A	T	2: 33,141,015	C570S	possibly damaging	Het
Scaf8	T	C	17: 3,178,255	S443P	unknown	Het
Setd5	A	G	6: 113,111,481	K190R	probably damaging	Het
Spsb4	T	A	9: 96,996,108	H54L	probably damaging	Het
St7l	T	A	3: 104,870,913	L122*	probably null	Het
Stom	C	T	2: 35,321,634	R125H	probably damaging	Het
Tigd4	T	A	3: 84,595,174	V466E	probably benign	Het
Tmc3	A	C	7: 83,607,819		probably benign	Het
Vcl	C	T	14: 20,985,624		probably benign	Het
Vmn1r168	G	A	7: 23,541,342	R208H	probably benign	Het
Vmn2r75	C	A	7: 86,165,080	V402L	probably benign	Het
Vps13b	A	T	15: 35,674,828	H1698L	probably damaging	Het
Wnt16	T	G	6: 22,297,993	V286G	possibly damaging	Het
Xirp1	C	A	9: 120,016,467	V1117L	probably benign	Het
Zfp788	C	T	7: 41,649,547	H536Y	probably damaging	Het

Other mutations in 3425401B19Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:3425401B19Rik	APN	14	32660916	missense	probably benign	0.18
IGL00844:3425401B19Rik	APN	14	32662999	nonsense	probably null
IGL01292:3425401B19Rik	APN	14	32660874	missense	probably benign	0.18
IGL01295:3425401B19Rik	APN	14	32661936	missense	possibly damaging	0.53
IGL01457:3425401B19Rik	APN	14	32660951	missense	probably benign
IGL01470:3425401B19Rik	APN	14	32660457	missense	possibly damaging	0.53
IGL01612:3425401B19Rik	APN	14	32660031	missense	possibly damaging	0.53
IGL01974:3425401B19Rik	APN	14	32659805	missense	possibly damaging	0.85
IGL02095:3425401B19Rik	APN	14	32661626	missense	probably benign	0.33
IGL02138:3425401B19Rik	APN	14	32662715	missense	possibly damaging	0.83
IGL02178:3425401B19Rik	APN	14	32662461	missense	possibly damaging	0.83
IGL02245:3425401B19Rik	APN	14	32659815	missense	probably benign	0.03
IGL02529:3425401B19Rik	APN	14	32661233	missense	probably benign
IGL03401:3425401B19Rik	APN	14	32662266	nonsense	probably null
PIT4515001:3425401B19Rik	UTSW	14	32661111	nonsense	probably null
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0519:3425401B19Rik	UTSW	14	32662962	missense	possibly damaging	0.92
R0551:3425401B19Rik	UTSW	14	32662641	missense	probably benign	0.03
R0759:3425401B19Rik	UTSW	14	32662497	missense	possibly damaging	0.93
R0831:3425401B19Rik	UTSW	14	32662271	missense	probably benign	0.01
R1124:3425401B19Rik	UTSW	14	32662082	missense	possibly damaging	0.53
R1346:3425401B19Rik	UTSW	14	32660814	missense	probably benign	0.07
R1997:3425401B19Rik	UTSW	14	32660048	missense	possibly damaging	0.71
R2055:3425401B19Rik	UTSW	14	32662551	missense	probably benign
R2212:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R2416:3425401B19Rik	UTSW	14	32663834	missense	probably benign	0.04
R2441:3425401B19Rik	UTSW	14	32663492	missense	possibly damaging	0.53
R2513:3425401B19Rik	UTSW	14	32661852	missense	possibly damaging	0.53
R3414:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R3800:3425401B19Rik	UTSW	14	32663068	missense	possibly damaging	0.83
R3809:3425401B19Rik	UTSW	14	32663693	missense	possibly damaging	0.96
R4166:3425401B19Rik	UTSW	14	32660955	missense	possibly damaging	0.53
R4581:3425401B19Rik	UTSW	14	32661871	missense	possibly damaging	0.73
R4721:3425401B19Rik	UTSW	14	32663150	missense	probably benign	0.01
R4769:3425401B19Rik	UTSW	14	32660217	missense	probably benign	0.32
R4809:3425401B19Rik	UTSW	14	32662631	missense	probably benign	0.19
R4919:3425401B19Rik	UTSW	14	32663288	missense	possibly damaging	0.85
R4925:3425401B19Rik	UTSW	14	32663180	missense	possibly damaging	0.86
R4972:3425401B19Rik	UTSW	14	32661404	missense	possibly damaging	0.73
R5068:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5069:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5070:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5258:3425401B19Rik	UTSW	14	32663309	missense	probably damaging	0.98
R5435:3425401B19Rik	UTSW	14	32661456	missense	probably benign	0.18
R5549:3425401B19Rik	UTSW	14	32663036	missense	possibly damaging	0.68
R5678:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5680:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5872:3425401B19Rik	UTSW	14	32660352	missense	possibly damaging	0.73
R5896:3425401B19Rik	UTSW	14	32661675	nonsense	probably null
R5940:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6044:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R6136:3425401B19Rik	UTSW	14	32662282	missense	possibly damaging	0.70
R6277:3425401B19Rik	UTSW	14	32663694	missense	possibly damaging	0.86
R6385:3425401B19Rik	UTSW	14	32661279	missense	probably benign	0.01
R6728:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6984:3425401B19Rik	UTSW	14	32661980	missense	probably benign	0.00
R7047:3425401B19Rik	UTSW	14	32660174	missense	possibly damaging	0.89
R7249:3425401B19Rik	UTSW	14	32663314	missense	possibly damaging	0.73
R7493:3425401B19Rik	UTSW	14	32663300	missense	possibly damaging	0.96
R7575:3425401B19Rik	UTSW	14	32662632	missense	probably benign	0.03
R7742:3425401B19Rik	UTSW	14	32662757	missense	possibly damaging	0.68
R7747:3425401B19Rik	UTSW	14	32663069	missense	possibly damaging	0.83
R7784:3425401B19Rik	UTSW	14	32659840	missense	probably benign	0.00
R8098:3425401B19Rik	UTSW	14	32662661	missense	probably damaging	0.99
R8111:3425401B19Rik	UTSW	14	32660309	nonsense	probably null
R8171:3425401B19Rik	UTSW	14	32662025	missense	probably benign
R8276:3425401B19Rik	UTSW	14	32663928	missense	probably damaging	0.97
R8330:3425401B19Rik	UTSW	14	32659793	missense	probably damaging	0.98
R8422:3425401B19Rik	UTSW	14	32662297	missense	possibly damaging	0.84
R8464:3425401B19Rik	UTSW	14	32659977	missense	possibly damaging	0.53
X0025:3425401B19Rik	UTSW	14	32662469	missense	probably damaging	0.98
Z1177:3425401B19Rik	UTSW	14	32659808	missense	possibly damaging	0.86
Z1177:3425401B19Rik	UTSW	14	32661398	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATTGCTCAGAGGTTCTTGCTTGC -3'
(R):5'- TGCTTTGGAAGACAAGAAACAGCCC -3'

Sequencing Primer
(F):5'- AGGTTCTTGCTTGCTATCAAGTTTAC -3'
(R):5'- GCCCAATAGGAGAGGTCTACC -3'

Posted On

2013-05-23