Incidental Mutation 'R0320:3425401B19Rik'
ID38308
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0320 (G1)
Quality Score216
Status Validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32662614 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 465 (T465A)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect probably benign
Transcript: ENSMUST00000096038
AA Change: T465A

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: T465A

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Aldh3b1 T C 19: 3,918,999 probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Cit C A 5: 115,979,445 L1227M possibly damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dopey2 C A 16: 93,810,147 R2113S probably benign Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Nrip1 T C 16: 76,292,363 T769A probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Olfr689 A T 7: 105,314,654 I217F probably benign Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Parp4 T C 14: 56,588,496 probably null Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tigd4 T A 3: 84,595,174 V466E probably benign Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATTGCTCAGAGGTTCTTGCTTGC -3'
(R):5'- TGCTTTGGAAGACAAGAAACAGCCC -3'

Sequencing Primer
(F):5'- AGGTTCTTGCTTGCTATCAAGTTTAC -3'
(R):5'- GCCCAATAGGAGAGGTCTACC -3'
Posted On2013-05-23