Incidental Mutation 'R4941:Zfp790'
ID383086
Institutional Source Beutler Lab
Gene Symbol Zfp790
Ensembl Gene ENSMUSG00000011427
Gene Namezinc finger protein 790
Synonyms6330581L23Rik
MMRRC Submission 042539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4941 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29816114-29831005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29829491 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 534 (C534S)
Ref Sequence ENSEMBL: ENSMUSP00000136932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032796] [ENSMUST00000108223] [ENSMUST00000178162]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032796
AA Change: C534S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032796
Gene: ENSMUSG00000011427
AA Change: C534S

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
Pfam:zf-C2H2_6 391 403 2.4e-1 PFAM
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108223
SMART Domains Protein: ENSMUSP00000103858
Gene: ENSMUSG00000050855

DomainStartEndE-ValueType
KRAB 6 67 2.42e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178162
AA Change: C534S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136932
Gene: ENSMUSG00000011427
AA Change: C534S

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Meta Mutation Damage Score 0.6844 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,917,702 H528P probably damaging Het
4932438A13Rik G A 3: 36,919,901 S600N probably benign Het
A4galt T A 15: 83,228,328 I85F probably damaging Het
Abcc6 T A 7: 46,012,523 I435F probably benign Het
Adam3 T C 8: 24,677,316 probably benign Het
Adrb3 T C 8: 27,227,422 Y333C probably damaging Het
Ago4 A T 4: 126,526,054 D43E probably benign Het
Agt T A 8: 124,556,988 Q464L probably benign Het
Amdhd1 A T 10: 93,531,601 D230E probably damaging Het
Aplf A G 6: 87,668,423 I33T probably damaging Het
Aplf A T 6: 87,646,349 N249K probably benign Het
Arap2 A G 5: 62,749,478 M66T probably benign Het
Atf4 T C 15: 80,256,233 probably benign Het
AU019823 G T 9: 50,607,509 Q268K probably benign Het
Bahcc1 A C 11: 120,286,665 H2068P probably benign Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Catsper1 C A 19: 5,341,438 A616D possibly damaging Het
Ccdc94 A G 17: 55,964,149 D97G possibly damaging Het
Cdkn3 A G 14: 46,769,863 D159G possibly damaging Het
Cep162 T C 9: 87,225,969 probably benign Het
Clca1 T A 3: 145,015,653 I386L probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cmtm3 T C 8: 104,343,828 L73P probably damaging Het
Cnksr3 A C 10: 7,152,925 L149R probably benign Het
Cope T C 8: 70,302,934 probably null Het
Cpa6 T A 1: 10,409,337 M224L probably benign Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Ddx55 T A 5: 124,568,716 L592* probably null Het
Deup1 T C 9: 15,588,027 M333V probably benign Het
Eif4a1 T C 11: 69,667,814 probably benign Het
Eif4g3 A C 4: 138,170,565 D1026A probably damaging Het
Eif5b T C 1: 38,051,199 V1153A probably damaging Het
Ercc8 G T 13: 108,160,767 probably benign Het
Fam227a C A 15: 79,640,003 probably null Het
Fat1 A G 8: 45,036,275 I3505V probably benign Het
Fat3 T G 9: 16,375,152 E1025A probably damaging Het
Fat4 C T 3: 38,957,452 R2234W probably damaging Het
Fer1l4 G T 2: 156,045,089 F634L probably damaging Het
Fetub G A 16: 22,937,874 V162I probably benign Het
Fgd4 T C 16: 16,484,538 Q51R probably benign Het
Fgfr2 T C 7: 130,198,445 H140R probably benign Het
Flt3 T A 5: 147,356,375 probably null Het
Gabrb1 A G 5: 72,136,778 N465S probably damaging Het
Gapdhs T C 7: 30,733,266 I206V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Glp2r T C 11: 67,746,703 probably null Het
Gm4956 T A 1: 21,298,082 noncoding transcript Het
Gtf2a1l A T 17: 88,714,922 D447V probably damaging Het
Hsd3b5 A G 3: 98,619,063 W356R probably damaging Het
Idh2 A T 7: 80,096,099 V335D probably damaging Het
Isyna1 T C 8: 70,595,496 I184T probably damaging Het
Kcnh2 A G 5: 24,331,087 S320P probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kpna6 A G 4: 129,648,032 F524S probably damaging Het
Lap3 A T 5: 45,506,197 M338L probably benign Het
Lins1 T C 7: 66,709,450 probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc43 A G 5: 123,501,063 D385G probably benign Het
Maf T C 8: 115,706,793 D24G unknown Het
Nell1 T C 7: 50,062,638 S69P probably benign Het
Olfr1342 C T 4: 118,689,892 V187I possibly damaging Het
Olfr1436 A G 19: 12,298,896 S79P possibly damaging Het
Olfr531 T A 7: 140,400,879 M56L probably benign Het
Olfr609 T C 7: 103,492,251 D209G probably damaging Het
Olfr91 C T 17: 37,093,592 G94E probably damaging Het
Olfr969 T C 9: 39,795,864 M163T possibly damaging Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Parp14 T C 16: 35,846,033 N1210S probably benign Het
Pcdhb10 C A 18: 37,412,834 T321K probably benign Het
Pcdhb8 C T 18: 37,356,006 L246F probably benign Het
Pcdhga1 T A 18: 37,662,606 I221K probably benign Het
Pcdhga9 T A 18: 37,738,132 V338E probably damaging Het
Pdcd11 T C 19: 47,119,886 S1231P probably damaging Het
Pde6c A T 19: 38,151,565 L325F probably damaging Het
Pnpla7 T A 2: 24,997,264 probably null Het
Pparg T A 6: 115,490,110 V478E probably damaging Het
Ppib T C 9: 66,060,390 V42A probably benign Het
Ppox T C 1: 171,277,593 M341V probably damaging Het
Proc T C 18: 32,125,113 K260E possibly damaging Het
Ptpro C T 6: 137,392,765 P525L probably damaging Het
Rnf14 C A 18: 38,308,382 A275E probably damaging Het
Scnn1b C T 7: 121,912,008 P306L probably damaging Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc26a5 A G 5: 21,820,386 I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 Y438C probably damaging Het
Spire1 T C 18: 67,519,314 E231G possibly damaging Het
Stab1 T A 14: 31,151,571 I1014F probably benign Het
Steap2 T C 5: 5,677,651 Y228C probably damaging Het
Tmem131l T C 3: 83,899,239 T1487A probably benign Het
Tmem171 A G 13: 98,692,295 F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 V199A probably damaging Het
Tmem45a T C 16: 56,822,289 N173S possibly damaging Het
Uqcrc2 C T 7: 120,643,078 R148C probably benign Het
Vmn2r116 A G 17: 23,401,142 K617E probably damaging Het
Xrcc6 T C 15: 82,039,812 L229P probably damaging Het
Zfp184 A G 13: 21,949,721 D46G probably damaging Het
Zfp990 A T 4: 145,536,837 N135I probably damaging Het
Other mutations in Zfp790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp790 APN 7 29828563 missense probably benign 0.32
IGL00979:Zfp790 APN 7 29829609 missense probably benign 0.00
IGL02286:Zfp790 APN 7 29829735 missense possibly damaging 0.53
IGL03136:Zfp790 APN 7 29829895 nonsense probably null
R0021:Zfp790 UTSW 7 29825688 unclassified probably benign
R0077:Zfp790 UTSW 7 29824875 missense probably damaging 0.98
R1477:Zfp790 UTSW 7 29823100 start gained probably benign
R1572:Zfp790 UTSW 7 29828139 missense probably benign 0.33
R2015:Zfp790 UTSW 7 29828861 missense probably benign 0.29
R5019:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5159:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5160:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5722:Zfp790 UTSW 7 29830089 nonsense probably null
R5954:Zfp790 UTSW 7 29829504 missense probably damaging 1.00
R6025:Zfp790 UTSW 7 29829545 missense possibly damaging 0.71
R6312:Zfp790 UTSW 7 29828222 missense probably damaging 1.00
R7392:Zfp790 UTSW 7 29828625 missense possibly damaging 0.52
R7623:Zfp790 UTSW 7 29825705 nonsense probably null
R8036:Zfp790 UTSW 7 29828921 missense possibly damaging 0.92
R8175:Zfp790 UTSW 7 29829780 missense possibly damaging 0.96
R8898:Zfp790 UTSW 7 29823100 start gained probably benign
Z1186:Zfp790 UTSW 7 29829684 missense possibly damaging 0.53
Z1186:Zfp790 UTSW 7 29829783 missense possibly damaging 0.72
Z1186:Zfp790 UTSW 7 29829833 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAAGGCTTTTAGTCTGCGCTC -3'
(R):5'- ACGTTCCCAGAGTTTCTCGC -3'

Sequencing Primer
(F):5'- AGTCTGCGCTCCATCGTTAGTAG -3'
(R):5'- AGAGTTTCTCGCCCGTAGG -3'
Posted On2016-04-27