Incidental Mutation 'R0320:Parp4'
ID38309
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Namepoly (ADP-ribose) polymerase family, member 4
Synonymsp193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0320 (G1)
Quality Score125
Status Validated
Chromosome14
Chromosomal Location56575619-56659794 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 56588496 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
Predicted Effect probably null
Transcript: ENSMUST00000161553
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,614 T465A probably benign Het
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Aldh3b1 T C 19: 3,918,999 probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Cit C A 5: 115,979,445 L1227M possibly damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dopey2 C A 16: 93,810,147 R2113S probably benign Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Nrip1 T C 16: 76,292,363 T769A probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Olfr689 A T 7: 105,314,654 I217F probably benign Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tigd4 T A 3: 84,595,174 V466E probably benign Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
poisonous UTSW 14 56635748 missense possibly damaging 0.65
toxic UTSW 14 56629158 missense probably benign 0.28
venomous UTSW 14 56589898 missense possibly damaging 0.92
virulent UTSW 14 56587778 missense probably damaging 0.97
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7808:Parp4 UTSW 14 56635748 missense possibly damaging 0.65
R7854:Parp4 UTSW 14 56659348 missense unknown
R7960:Parp4 UTSW 14 56595251 splice site probably null
R8152:Parp4 UTSW 14 56647246 missense probably benign 0.00
R8344:Parp4 UTSW 14 56648729 missense unknown
R8416:Parp4 UTSW 14 56587814 critical splice donor site probably null
R8726:Parp4 UTSW 14 56629099 missense probably benign 0.04
R8752:Parp4 UTSW 14 56648616 missense unknown
R8804:Parp4 UTSW 14 56616443 nonsense probably null
RF020:Parp4 UTSW 14 56647349 missense unknown
Z1177:Parp4 UTSW 14 56592367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGCACCAGAGGCTCAGT -3'
(R):5'- GTTCATCTCTAACGCCATGCTAACACT -3'

Sequencing Primer
(F):5'- GTACATTAGGAGTTAGGGGCTC -3'
(R):5'- CCAACTCGTGCTACAGGATATTT -3'
Posted On2013-05-23