Incidental Mutation 'R0320:Parp4'
ID38309
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Namepoly (ADP-ribose) polymerase family, member 4
Synonymsp193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0320 (G1)
Quality Score125
Status Validated
Chromosome14
Chromosomal Location56575619-56659794 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 56588496 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
Predicted Effect probably null
Transcript: ENSMUST00000161553
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,614 T465A probably benign Het
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Aldh3b1 T C 19: 3,918,999 probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Cit C A 5: 115,979,445 L1227M possibly damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dopey2 C A 16: 93,810,147 R2113S probably benign Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Nrip1 T C 16: 76,292,363 T769A probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Olfr689 A T 7: 105,314,654 I217F probably benign Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tigd4 T A 3: 84,595,174 V466E probably benign Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7808:Parp4 UTSW 14 56635748 missense possibly damaging 0.65
RF020:Parp4 UTSW 14 56647349 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGGCACCAGAGGCTCAGT -3'
(R):5'- GTTCATCTCTAACGCCATGCTAACACT -3'

Sequencing Primer
(F):5'- GTACATTAGGAGTTAGGGGCTC -3'
(R):5'- CCAACTCGTGCTACAGGATATTT -3'
Posted On2013-05-23