Incidental Mutation 'R4941:Agt'
ID383105
Institutional Source Beutler Lab
Gene Symbol Agt
Ensembl Gene ENSMUSG00000031980
Gene Nameangiotensinogen (serpin peptidase inhibitor, clade A, member 8)
SynonymsAogen, angiotensin precursor, Serpina8
MMRRC Submission 042539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4941 (G1)
Quality Score119
Status Validated
Chromosome8
Chromosomal Location124556534-124569706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124556988 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 464 (Q464L)
Ref Sequence ENSEMBL: ENSMUSP00000066488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000063278]
Predicted Effect probably benign
Transcript: ENSMUST00000034460
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063278
AA Change: Q464L

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066488
Gene: ENSMUSG00000031980
AA Change: Q464L

DomainStartEndE-ValueType
SERPIN 111 478 6.63e-57 SMART
Meta Mutation Damage Score 0.2026 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in small body size and lower body fat, decreased blood pressure and hypotension, kidney abnormalities, polydipsia and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,917,702 H528P probably damaging Het
4932438A13Rik G A 3: 36,919,901 S600N probably benign Het
A4galt T A 15: 83,228,328 I85F probably damaging Het
Abcc6 T A 7: 46,012,523 I435F probably benign Het
Adam3 T C 8: 24,677,316 probably benign Het
Adrb3 T C 8: 27,227,422 Y333C probably damaging Het
Ago4 A T 4: 126,526,054 D43E probably benign Het
Amdhd1 A T 10: 93,531,601 D230E probably damaging Het
Aplf A T 6: 87,646,349 N249K probably benign Het
Aplf A G 6: 87,668,423 I33T probably damaging Het
Arap2 A G 5: 62,749,478 M66T probably benign Het
Atf4 T C 15: 80,256,233 probably benign Het
AU019823 G T 9: 50,607,509 Q268K probably benign Het
Bahcc1 A C 11: 120,286,665 H2068P probably benign Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Catsper1 C A 19: 5,341,438 A616D possibly damaging Het
Ccdc94 A G 17: 55,964,149 D97G possibly damaging Het
Cdkn3 A G 14: 46,769,863 D159G possibly damaging Het
Cep162 T C 9: 87,225,969 probably benign Het
Clca1 T A 3: 145,015,653 I386L probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cmtm3 T C 8: 104,343,828 L73P probably damaging Het
Cnksr3 A C 10: 7,152,925 L149R probably benign Het
Cope T C 8: 70,302,934 probably null Het
Cpa6 T A 1: 10,409,337 M224L probably benign Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Ddx55 T A 5: 124,568,716 L592* probably null Het
Deup1 T C 9: 15,588,027 M333V probably benign Het
Eif4a1 T C 11: 69,667,814 probably benign Het
Eif4g3 A C 4: 138,170,565 D1026A probably damaging Het
Eif5b T C 1: 38,051,199 V1153A probably damaging Het
Ercc8 G T 13: 108,160,767 probably benign Het
Fam227a C A 15: 79,640,003 probably null Het
Fat1 A G 8: 45,036,275 I3505V probably benign Het
Fat3 T G 9: 16,375,152 E1025A probably damaging Het
Fat4 C T 3: 38,957,452 R2234W probably damaging Het
Fer1l4 G T 2: 156,045,089 F634L probably damaging Het
Fetub G A 16: 22,937,874 V162I probably benign Het
Fgd4 T C 16: 16,484,538 Q51R probably benign Het
Fgfr2 T C 7: 130,198,445 H140R probably benign Het
Flt3 T A 5: 147,356,375 probably null Het
Gabrb1 A G 5: 72,136,778 N465S probably damaging Het
Gapdhs T C 7: 30,733,266 I206V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Glp2r T C 11: 67,746,703 probably null Het
Gm4956 T A 1: 21,298,082 noncoding transcript Het
Gtf2a1l A T 17: 88,714,922 D447V probably damaging Het
Hsd3b5 A G 3: 98,619,063 W356R probably damaging Het
Idh2 A T 7: 80,096,099 V335D probably damaging Het
Isyna1 T C 8: 70,595,496 I184T probably damaging Het
Kcnh2 A G 5: 24,331,087 S320P probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kpna6 A G 4: 129,648,032 F524S probably damaging Het
Lap3 A T 5: 45,506,197 M338L probably benign Het
Lins1 T C 7: 66,709,450 probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc43 A G 5: 123,501,063 D385G probably benign Het
Maf T C 8: 115,706,793 D24G unknown Het
Nell1 T C 7: 50,062,638 S69P probably benign Het
Olfr1342 C T 4: 118,689,892 V187I possibly damaging Het
Olfr1436 A G 19: 12,298,896 S79P possibly damaging Het
Olfr531 T A 7: 140,400,879 M56L probably benign Het
Olfr609 T C 7: 103,492,251 D209G probably damaging Het
Olfr91 C T 17: 37,093,592 G94E probably damaging Het
Olfr969 T C 9: 39,795,864 M163T possibly damaging Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Parp14 T C 16: 35,846,033 N1210S probably benign Het
Pcdhb10 C A 18: 37,412,834 T321K probably benign Het
Pcdhb8 C T 18: 37,356,006 L246F probably benign Het
Pcdhga1 T A 18: 37,662,606 I221K probably benign Het
Pcdhga9 T A 18: 37,738,132 V338E probably damaging Het
Pdcd11 T C 19: 47,119,886 S1231P probably damaging Het
Pde6c A T 19: 38,151,565 L325F probably damaging Het
Pnpla7 T A 2: 24,997,264 probably null Het
Pparg T A 6: 115,490,110 V478E probably damaging Het
Ppib T C 9: 66,060,390 V42A probably benign Het
Ppox T C 1: 171,277,593 M341V probably damaging Het
Proc T C 18: 32,125,113 K260E possibly damaging Het
Ptpro C T 6: 137,392,765 P525L probably damaging Het
Rnf14 C A 18: 38,308,382 A275E probably damaging Het
Scnn1b C T 7: 121,912,008 P306L probably damaging Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc26a5 A G 5: 21,820,386 I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 Y438C probably damaging Het
Spire1 T C 18: 67,519,314 E231G possibly damaging Het
Stab1 T A 14: 31,151,571 I1014F probably benign Het
Steap2 T C 5: 5,677,651 Y228C probably damaging Het
Tmem131l T C 3: 83,899,239 T1487A probably benign Het
Tmem171 A G 13: 98,692,295 F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 V199A probably damaging Het
Tmem45a T C 16: 56,822,289 N173S possibly damaging Het
Uqcrc2 C T 7: 120,643,078 R148C probably benign Het
Vmn2r116 A G 17: 23,401,142 K617E probably damaging Het
Xrcc6 T C 15: 82,039,812 L229P probably damaging Het
Zfp184 A G 13: 21,949,721 D46G probably damaging Het
Zfp790 T A 7: 29,829,491 C534S possibly damaging Het
Zfp990 A T 4: 145,536,837 N135I probably damaging Het
Other mutations in Agt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Agt APN 8 124557895 splice site probably benign
IGL01648:Agt APN 8 124564406 missense probably benign 0.01
IGL02145:Agt APN 8 124564448 missense probably damaging 0.99
IGL02929:Agt APN 8 124557090 missense probably benign
IGL02978:Agt APN 8 124557763 missense possibly damaging 0.93
IGL03207:Agt APN 8 124559368 missense probably damaging 0.98
R0518:Agt UTSW 8 124557100 nonsense probably null
R0521:Agt UTSW 8 124557100 nonsense probably null
R0562:Agt UTSW 8 124559275 missense probably benign 0.00
R0591:Agt UTSW 8 124556939 missense possibly damaging 0.77
R0646:Agt UTSW 8 124557113 missense probably damaging 1.00
R1495:Agt UTSW 8 124559455 missense probably damaging 1.00
R2568:Agt UTSW 8 124556955 missense probably damaging 1.00
R4750:Agt UTSW 8 124556937 missense probably benign
R5782:Agt UTSW 8 124557131 splice site probably null
R5916:Agt UTSW 8 124563858 missense possibly damaging 0.70
R6332:Agt UTSW 8 124557833 missense possibly damaging 0.92
R7769:Agt UTSW 8 124564550 missense probably benign 0.41
R8354:Agt UTSW 8 124564103 missense probably benign 0.06
R8443:Agt UTSW 8 124563798 missense possibly damaging 0.82
R8454:Agt UTSW 8 124564103 missense probably benign 0.06
R8808:Agt UTSW 8 124564289 missense probably benign 0.01
R8911:Agt UTSW 8 124564445 missense probably benign 0.00
X0067:Agt UTSW 8 124556955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATTCTCGGTCAGCGCAGTC -3'
(R):5'- CCACTTAGAGGACAGGTGTG -3'

Sequencing Primer
(F):5'- TCAGCGCAGTCTCCAAGGAG -3'
(R):5'- TTCCTTCTGGCAGGCTGGAC -3'
Posted On2016-04-27