Incidental Mutation 'R4941:Fat3'
ID 383107
Institutional Source Beutler Lab
Gene Symbol Fat3
Ensembl Gene ENSMUSG00000074505
Gene Name FAT atypical cadherin 3
Synonyms D430038H04Rik, LOC382129, LOC234973, 9430076A06Rik
MMRRC Submission 042539-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.714) question?
Stock # R4941 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 15821485-16412581 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 16286448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1025 (E1025A)
Ref Sequence ENSEMBL: ENSMUSP00000148968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082170] [ENSMUST00000217308]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082170
AA Change: E1025A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080808
Gene: ENSMUSG00000074505
AA Change: E1025A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 65 151 3e-7 SMART
CA 175 259 8.9e-22 SMART
CA 280 368 8.9e-4 SMART
CA 389 465 2.6e-11 SMART
CA 489 571 2e-29 SMART
low complexity region 684 697 N/A INTRINSIC
CA 743 824 1e-24 SMART
low complexity region 830 840 N/A INTRINSIC
CA 848 929 7.6e-26 SMART
CA 953 1034 1.5e-25 SMART
CA 1060 1141 6.6e-32 SMART
CA 1165 1247 1.5e-30 SMART
CA 1273 1349 1.8e-8 SMART
CA 1375 1453 2.9e-12 SMART
CA 1477 1559 3e-22 SMART
CA 1583 1664 3.1e-16 SMART
CA 1688 1762 4.2e-22 SMART
CA 1793 1876 2.5e-26 SMART
CA 1900 1975 1.5e-8 SMART
low complexity region 1983 1994 N/A INTRINSIC
CA 1999 2077 1.4e-18 SMART
CA 2101 2179 6.6e-10 SMART
CA 2203 2280 4.9e-19 SMART
CA 2304 2387 4.3e-29 SMART
CA 2411 2489 4.2e-11 SMART
CA 2513 2593 2.8e-22 SMART
CA 2617 2701 4.3e-10 SMART
CA 2719 2807 2.5e-7 SMART
CA 2831 2917 3.3e-27 SMART
CA 2941 3022 9.4e-23 SMART
CA 3046 3124 2.4e-26 SMART
CA 3148 3229 1.3e-32 SMART
CA 3253 3334 1.3e-29 SMART
CA 3358 3439 4.9e-28 SMART
CA 3463 3544 6.4e-12 SMART
EGF 3793 3828 1.3e-1 SMART
LamG 3852 3989 4.3e-25 SMART
EGF 4019 4053 2.7e-6 SMART
EGF 4058 4091 4.5e-6 SMART
EGF_CA 4093 4129 3.9e-11 SMART
transmembrane domain 4151 4170 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217308
AA Change: E1025A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1355 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype PHENOTYPE: Mice homozgyous for a knock-out allele exhibit abnormal amacrine cell differentiation and migration that result in the formation of two additional plexiform layers and thickened retinal ganglion layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,112,529 (GRCm39) I85F probably damaging Het
Abcc6 T A 7: 45,661,947 (GRCm39) I435F probably benign Het
Adam3 T C 8: 25,167,332 (GRCm39) probably benign Het
Adrb3 T C 8: 27,717,450 (GRCm39) Y333C probably damaging Het
Ago4 A T 4: 126,419,847 (GRCm39) D43E probably benign Het
Agt T A 8: 125,283,727 (GRCm39) Q464L probably benign Het
Amdhd1 A T 10: 93,367,463 (GRCm39) D230E probably damaging Het
Aplf A G 6: 87,645,405 (GRCm39) I33T probably damaging Het
Aplf A T 6: 87,623,331 (GRCm39) N249K probably benign Het
Arap2 A G 5: 62,906,821 (GRCm39) M66T probably benign Het
Atf4 T C 15: 80,140,434 (GRCm39) probably benign Het
Bahcc1 A C 11: 120,177,491 (GRCm39) H2068P probably benign Het
Bcor C T X: 11,906,725 (GRCm39) R1551Q probably damaging Het
Bltp1 A C 3: 36,971,851 (GRCm39) H528P probably damaging Het
Bltp1 G A 3: 36,974,050 (GRCm39) S600N probably benign Het
Catsper1 C A 19: 5,391,466 (GRCm39) A616D possibly damaging Het
Cdkn3 A G 14: 47,007,320 (GRCm39) D159G possibly damaging Het
Cep162 T C 9: 87,108,022 (GRCm39) probably benign Het
Clca3a1 T A 3: 144,721,414 (GRCm39) I386L probably damaging Het
Cldn10 G A 14: 119,025,725 (GRCm39) G53S possibly damaging Het
Cmtm3 T C 8: 105,070,460 (GRCm39) L73P probably damaging Het
Cnksr3 A C 10: 7,102,925 (GRCm39) L149R probably benign Het
Cope T C 8: 70,755,584 (GRCm39) probably null Het
Cpa6 T A 1: 10,479,562 (GRCm39) M224L probably benign Het
Cyp2d41-ps T C 15: 82,666,154 (GRCm39) noncoding transcript Het
Ddx55 T A 5: 124,706,779 (GRCm39) L592* probably null Het
Deup1 T C 9: 15,499,323 (GRCm39) M333V probably benign Het
Eif4a1 T C 11: 69,558,640 (GRCm39) probably benign Het
Eif4g3 A C 4: 137,897,876 (GRCm39) D1026A probably damaging Het
Eif5b T C 1: 38,090,280 (GRCm39) V1153A probably damaging Het
Ercc8 G T 13: 108,297,301 (GRCm39) probably benign Het
Fam227a C A 15: 79,524,204 (GRCm39) probably null Het
Fat1 A G 8: 45,489,312 (GRCm39) I3505V probably benign Het
Fat4 C T 3: 39,011,601 (GRCm39) R2234W probably damaging Het
Fer1l4 G T 2: 155,887,009 (GRCm39) F634L probably damaging Het
Fetub G A 16: 22,756,624 (GRCm39) V162I probably benign Het
Fgd4 T C 16: 16,302,402 (GRCm39) Q51R probably benign Het
Fgfr2 T C 7: 129,800,175 (GRCm39) H140R probably benign Het
Flt3 T A 5: 147,293,185 (GRCm39) probably null Het
Gabrb1 A G 5: 72,294,121 (GRCm39) N465S probably damaging Het
Gapdhs T C 7: 30,432,691 (GRCm39) I206V probably benign Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Glp2r T C 11: 67,637,529 (GRCm39) probably null Het
Gm4956 T A 1: 21,368,306 (GRCm39) noncoding transcript Het
Gtf2a1l A T 17: 89,022,350 (GRCm39) D447V probably damaging Het
Hsd3b5 A G 3: 98,526,379 (GRCm39) W356R probably damaging Het
Idh2 A T 7: 79,745,847 (GRCm39) V335D probably damaging Het
Isyna1 T C 8: 71,048,146 (GRCm39) I184T probably damaging Het
Kcnh2 A G 5: 24,536,085 (GRCm39) S320P probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kpna6 A G 4: 129,541,825 (GRCm39) F524S probably damaging Het
Lap3 A T 5: 45,663,539 (GRCm39) M338L probably benign Het
Lins1 T C 7: 66,359,198 (GRCm39) probably benign Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lrrc43 A G 5: 123,639,126 (GRCm39) D385G probably benign Het
Maf T C 8: 116,433,532 (GRCm39) D24G unknown Het
Nell1 T C 7: 49,712,386 (GRCm39) S69P probably benign Het
Nkapd1 G T 9: 50,518,809 (GRCm39) Q268K probably benign Het
Or13p4 C T 4: 118,547,089 (GRCm39) V187I possibly damaging Het
Or2h1 C T 17: 37,404,484 (GRCm39) G94E probably damaging Het
Or2j6 T A 7: 139,980,792 (GRCm39) M56L probably benign Het
Or51af1 T C 7: 103,141,458 (GRCm39) D209G probably damaging Het
Or5an10 A G 19: 12,276,260 (GRCm39) S79P possibly damaging Het
Or8g54 T C 9: 39,707,160 (GRCm39) M163T possibly damaging Het
Oxld1 T C 11: 120,347,862 (GRCm39) T112A probably benign Het
Parp14 T C 16: 35,666,403 (GRCm39) N1210S probably benign Het
Pcdhb10 C A 18: 37,545,887 (GRCm39) T321K probably benign Het
Pcdhb8 C T 18: 37,489,059 (GRCm39) L246F probably benign Het
Pcdhga1 T A 18: 37,795,659 (GRCm39) I221K probably benign Het
Pcdhga9 T A 18: 37,871,185 (GRCm39) V338E probably damaging Het
Pdcd11 T C 19: 47,108,325 (GRCm39) S1231P probably damaging Het
Pde6c A T 19: 38,140,013 (GRCm39) L325F probably damaging Het
Pnpla7 T A 2: 24,887,276 (GRCm39) probably null Het
Pparg T A 6: 115,467,071 (GRCm39) V478E probably damaging Het
Ppib T C 9: 65,967,672 (GRCm39) V42A probably benign Het
Ppox T C 1: 171,105,166 (GRCm39) M341V probably damaging Het
Proc T C 18: 32,258,166 (GRCm39) K260E possibly damaging Het
Ptpro C T 6: 137,369,763 (GRCm39) P525L probably damaging Het
Rnf14 C A 18: 38,441,435 (GRCm39) A275E probably damaging Het
Scnn1b C T 7: 121,511,231 (GRCm39) P306L probably damaging Het
Sec14l5 A G 16: 4,994,364 (GRCm39) E386G probably damaging Het
Sftpa1 T A 14: 40,854,509 (GRCm39) I32N probably damaging Het
Slc26a5 A G 5: 22,025,384 (GRCm39) I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 (GRCm39) Y438C probably damaging Het
Spire1 T C 18: 67,652,384 (GRCm39) E231G possibly damaging Het
Stab1 T A 14: 30,873,528 (GRCm39) I1014F probably benign Het
Steap2 T C 5: 5,727,651 (GRCm39) Y228C probably damaging Het
Tmem131l T C 3: 83,806,546 (GRCm39) T1487A probably benign Het
Tmem171 A G 13: 98,828,803 (GRCm39) F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 (GRCm39) V199A probably damaging Het
Tmem45a T C 16: 56,642,652 (GRCm39) N173S possibly damaging Het
Uqcrc2 C T 7: 120,242,301 (GRCm39) R148C probably benign Het
Vmn2r116 A G 17: 23,620,116 (GRCm39) K617E probably damaging Het
Xrcc6 T C 15: 81,924,013 (GRCm39) L229P probably damaging Het
Yju2 A G 17: 56,271,149 (GRCm39) D97G possibly damaging Het
Zfp184 A G 13: 22,133,891 (GRCm39) D46G probably damaging Het
Zfp790 T A 7: 29,528,916 (GRCm39) C534S possibly damaging Het
Zfp990 A T 4: 145,263,407 (GRCm39) N135I probably damaging Het
Other mutations in Fat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Fat3 APN 9 15,907,723 (GRCm39) missense possibly damaging 0.77
IGL00962:Fat3 APN 9 15,826,815 (GRCm39) missense probably benign 0.14
IGL00966:Fat3 APN 9 15,910,390 (GRCm39) missense possibly damaging 0.69
IGL01100:Fat3 APN 9 16,286,524 (GRCm39) missense probably damaging 1.00
IGL01104:Fat3 APN 9 16,287,024 (GRCm39) missense possibly damaging 0.92
IGL01104:Fat3 APN 9 15,909,756 (GRCm39) missense probably damaging 1.00
IGL01121:Fat3 APN 9 15,909,697 (GRCm39) missense probably benign 0.00
IGL01407:Fat3 APN 9 16,289,319 (GRCm39) missense probably benign 0.01
IGL01444:Fat3 APN 9 15,910,144 (GRCm39) missense probably damaging 1.00
IGL01634:Fat3 APN 9 15,909,654 (GRCm39) missense probably damaging 1.00
IGL01649:Fat3 APN 9 16,288,015 (GRCm39) missense possibly damaging 0.95
IGL01839:Fat3 APN 9 15,909,168 (GRCm39) missense probably damaging 1.00
IGL01867:Fat3 APN 9 16,289,197 (GRCm39) missense probably benign 0.03
IGL01894:Fat3 APN 9 16,287,145 (GRCm39) missense probably benign
IGL01913:Fat3 APN 9 15,910,086 (GRCm39) missense probably damaging 0.99
IGL02033:Fat3 APN 9 15,826,648 (GRCm39) missense possibly damaging 0.50
IGL02035:Fat3 APN 9 16,289,266 (GRCm39) missense probably benign 0.06
IGL02146:Fat3 APN 9 15,910,878 (GRCm39) missense probably benign
IGL02147:Fat3 APN 9 15,907,281 (GRCm39) missense probably damaging 1.00
IGL02161:Fat3 APN 9 15,908,346 (GRCm39) missense probably benign 0.10
IGL02161:Fat3 APN 9 15,908,347 (GRCm39) nonsense probably null
IGL02164:Fat3 APN 9 15,942,720 (GRCm39) splice site probably benign
IGL02269:Fat3 APN 9 15,826,873 (GRCm39) missense possibly damaging 0.84
IGL02314:Fat3 APN 9 15,881,134 (GRCm39) missense possibly damaging 0.61
IGL02393:Fat3 APN 9 15,899,708 (GRCm39) nonsense probably null
IGL02410:Fat3 APN 9 15,909,141 (GRCm39) missense probably damaging 1.00
IGL02504:Fat3 APN 9 15,871,094 (GRCm39) missense probably damaging 1.00
IGL02572:Fat3 APN 9 15,871,802 (GRCm39) missense probably benign
IGL02623:Fat3 APN 9 15,908,433 (GRCm39) missense probably damaging 1.00
IGL02654:Fat3 APN 9 15,908,271 (GRCm39) missense possibly damaging 0.84
IGL02749:Fat3 APN 9 15,918,007 (GRCm39) missense possibly damaging 0.93
IGL02810:Fat3 APN 9 16,288,146 (GRCm39) missense probably damaging 1.00
IGL02839:Fat3 APN 9 15,830,466 (GRCm39) missense probably damaging 1.00
IGL02890:Fat3 APN 9 15,826,636 (GRCm39) missense probably benign 0.03
IGL02892:Fat3 APN 9 16,288,858 (GRCm39) missense probably damaging 1.00
IGL03090:Fat3 APN 9 16,288,535 (GRCm39) nonsense probably null
IGL03144:Fat3 APN 9 16,286,541 (GRCm39) missense probably damaging 1.00
IGL03199:Fat3 APN 9 16,288,344 (GRCm39) missense possibly damaging 0.83
IGL03365:Fat3 APN 9 15,907,765 (GRCm39) missense probably damaging 1.00
IGL03392:Fat3 APN 9 15,915,158 (GRCm39) missense probably benign
IGL03408:Fat3 APN 9 15,909,253 (GRCm39) nonsense probably null
gagged UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
hushed UTSW 9 15,871,165 (GRCm39) missense possibly damaging 0.72
Muffled UTSW 9 15,849,287 (GRCm39) critical splice donor site probably null
muted UTSW 9 15,908,773 (GRCm39) missense possibly damaging 0.93
Softened UTSW 9 16,289,481 (GRCm39) missense probably benign
BB001:Fat3 UTSW 9 15,910,593 (GRCm39) missense probably damaging 1.00
BB002:Fat3 UTSW 9 15,942,656 (GRCm39) missense possibly damaging 0.77
BB011:Fat3 UTSW 9 15,910,593 (GRCm39) missense probably damaging 1.00
BB012:Fat3 UTSW 9 15,942,656 (GRCm39) missense possibly damaging 0.77
F6893:Fat3 UTSW 9 15,918,085 (GRCm39) missense probably damaging 0.99
IGL03050:Fat3 UTSW 9 15,907,896 (GRCm39) missense probably benign 0.04
PIT4142001:Fat3 UTSW 9 15,903,414 (GRCm39) critical splice donor site probably null
PIT4283001:Fat3 UTSW 9 15,917,897 (GRCm39) missense possibly damaging 0.77
PIT4378001:Fat3 UTSW 9 16,288,104 (GRCm39) missense probably benign 0.05
PIT4434001:Fat3 UTSW 9 15,907,612 (GRCm39) missense probably benign 0.00
PIT4468001:Fat3 UTSW 9 15,907,647 (GRCm39) missense probably benign 0.06
R0001:Fat3 UTSW 9 16,289,169 (GRCm39) missense probably damaging 0.99
R0005:Fat3 UTSW 9 15,874,162 (GRCm39) missense probably damaging 1.00
R0005:Fat3 UTSW 9 15,874,162 (GRCm39) missense probably damaging 1.00
R0038:Fat3 UTSW 9 15,826,306 (GRCm39) missense probably damaging 1.00
R0046:Fat3 UTSW 9 15,877,275 (GRCm39) missense possibly damaging 0.65
R0089:Fat3 UTSW 9 15,849,501 (GRCm39) missense probably benign
R0135:Fat3 UTSW 9 15,918,073 (GRCm39) missense probably damaging 1.00
R0255:Fat3 UTSW 9 15,881,002 (GRCm39) splice site probably benign
R0349:Fat3 UTSW 9 15,942,476 (GRCm39) missense probably damaging 1.00
R0361:Fat3 UTSW 9 15,909,699 (GRCm39) missense possibly damaging 0.77
R0382:Fat3 UTSW 9 15,871,052 (GRCm39) missense probably damaging 1.00
R0418:Fat3 UTSW 9 16,158,192 (GRCm39) missense probably damaging 1.00
R0419:Fat3 UTSW 9 15,903,552 (GRCm39) missense probably damaging 1.00
R0437:Fat3 UTSW 9 15,908,228 (GRCm39) missense probably damaging 1.00
R0441:Fat3 UTSW 9 15,856,304 (GRCm39) splice site probably benign
R0480:Fat3 UTSW 9 15,909,025 (GRCm39) missense probably benign 0.00
R0510:Fat3 UTSW 9 15,910,981 (GRCm39) nonsense probably null
R0665:Fat3 UTSW 9 15,908,698 (GRCm39) missense probably benign
R0715:Fat3 UTSW 9 16,286,419 (GRCm39) missense probably benign
R0727:Fat3 UTSW 9 15,907,995 (GRCm39) missense probably damaging 1.00
R0882:Fat3 UTSW 9 15,942,664 (GRCm39) missense possibly damaging 0.84
R0946:Fat3 UTSW 9 15,909,100 (GRCm39) missense possibly damaging 0.95
R1068:Fat3 UTSW 9 15,881,330 (GRCm39) missense probably benign
R1081:Fat3 UTSW 9 16,286,580 (GRCm39) missense possibly damaging 0.62
R1082:Fat3 UTSW 9 15,917,911 (GRCm39) missense probably damaging 1.00
R1148:Fat3 UTSW 9 15,908,070 (GRCm39) missense probably damaging 1.00
R1148:Fat3 UTSW 9 15,908,070 (GRCm39) missense probably damaging 1.00
R1233:Fat3 UTSW 9 15,834,041 (GRCm39) missense probably benign
R1306:Fat3 UTSW 9 16,287,975 (GRCm39) missense probably damaging 1.00
R1311:Fat3 UTSW 9 15,932,706 (GRCm39) missense probably damaging 1.00
R1338:Fat3 UTSW 9 15,836,387 (GRCm39) missense probably benign 0.00
R1395:Fat3 UTSW 9 16,158,212 (GRCm39) missense probably benign 0.00
R1466:Fat3 UTSW 9 16,286,778 (GRCm39) missense probably damaging 0.96
R1466:Fat3 UTSW 9 16,286,778 (GRCm39) missense probably damaging 0.96
R1510:Fat3 UTSW 9 15,871,351 (GRCm39) missense probably damaging 1.00
R1528:Fat3 UTSW 9 15,836,387 (GRCm39) missense probably benign 0.00
R1531:Fat3 UTSW 9 15,908,761 (GRCm39) missense probably damaging 1.00
R1659:Fat3 UTSW 9 15,908,479 (GRCm39) missense possibly damaging 0.91
R1697:Fat3 UTSW 9 15,856,176 (GRCm39) missense probably benign 0.05
R1699:Fat3 UTSW 9 15,849,694 (GRCm39) missense probably damaging 1.00
R1728:Fat3 UTSW 9 15,907,611 (GRCm39) missense possibly damaging 0.65
R1729:Fat3 UTSW 9 15,907,611 (GRCm39) missense possibly damaging 0.65
R1731:Fat3 UTSW 9 15,907,233 (GRCm39) missense probably benign
R1784:Fat3 UTSW 9 15,907,611 (GRCm39) missense possibly damaging 0.65
R1789:Fat3 UTSW 9 16,288,281 (GRCm39) missense probably benign 0.00
R1794:Fat3 UTSW 9 15,908,434 (GRCm39) missense probably benign 0.15
R1794:Fat3 UTSW 9 15,908,432 (GRCm39) nonsense probably null
R1830:Fat3 UTSW 9 15,826,636 (GRCm39) missense probably benign 0.03
R1835:Fat3 UTSW 9 15,909,384 (GRCm39) missense probably damaging 1.00
R1887:Fat3 UTSW 9 15,878,357 (GRCm39) missense probably damaging 1.00
R1898:Fat3 UTSW 9 15,871,426 (GRCm39) missense probably damaging 1.00
R1909:Fat3 UTSW 9 15,909,411 (GRCm39) missense probably benign
R1912:Fat3 UTSW 9 15,881,284 (GRCm39) missense probably damaging 1.00
R1917:Fat3 UTSW 9 15,908,353 (GRCm39) missense possibly damaging 0.55
R1967:Fat3 UTSW 9 15,879,591 (GRCm39) missense probably benign 0.00
R2070:Fat3 UTSW 9 15,910,666 (GRCm39) missense probably benign 0.21
R2100:Fat3 UTSW 9 16,288,726 (GRCm39) missense possibly damaging 0.73
R2104:Fat3 UTSW 9 15,909,813 (GRCm39) missense possibly damaging 0.77
R2113:Fat3 UTSW 9 15,911,082 (GRCm39) missense probably damaging 1.00
R2132:Fat3 UTSW 9 16,158,015 (GRCm39) critical splice donor site probably null
R2136:Fat3 UTSW 9 16,288,347 (GRCm39) missense probably benign 0.01
R2146:Fat3 UTSW 9 15,901,808 (GRCm39) missense probably benign 0.01
R2233:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R2234:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R2273:Fat3 UTSW 9 15,826,558 (GRCm39) missense probably benign
R2285:Fat3 UTSW 9 16,287,469 (GRCm39) missense probably damaging 1.00
R2363:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R2365:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R2367:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R2403:Fat3 UTSW 9 15,881,167 (GRCm39) missense probably damaging 1.00
R2447:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R2496:Fat3 UTSW 9 15,877,399 (GRCm39) missense probably benign 0.01
R2509:Fat3 UTSW 9 15,836,310 (GRCm39) missense possibly damaging 0.82
R2932:Fat3 UTSW 9 16,287,240 (GRCm39) missense probably damaging 1.00
R2986:Fat3 UTSW 9 15,903,424 (GRCm39) missense probably damaging 1.00
R3054:Fat3 UTSW 9 15,871,792 (GRCm39) missense probably benign
R3056:Fat3 UTSW 9 15,871,792 (GRCm39) missense probably benign
R3729:Fat3 UTSW 9 16,158,337 (GRCm39) splice site probably benign
R3745:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R3806:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R3859:Fat3 UTSW 9 15,908,524 (GRCm39) nonsense probably null
R3862:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R3890:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R3892:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R3950:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R3972:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4004:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4005:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4086:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4111:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4113:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4227:Fat3 UTSW 9 16,288,989 (GRCm39) missense probably damaging 1.00
R4352:Fat3 UTSW 9 16,158,074 (GRCm39) missense possibly damaging 0.55
R4394:Fat3 UTSW 9 15,834,088 (GRCm39) missense probably benign 0.11
R4403:Fat3 UTSW 9 15,856,169 (GRCm39) missense probably damaging 1.00
R4433:Fat3 UTSW 9 15,942,448 (GRCm39) missense probably damaging 0.99
R4453:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4479:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4480:Fat3 UTSW 9 15,909,567 (GRCm39) missense probably damaging 1.00
R4521:Fat3 UTSW 9 15,834,238 (GRCm39) missense probably null 0.71
R4620:Fat3 UTSW 9 15,908,190 (GRCm39) missense probably damaging 1.00
R4700:Fat3 UTSW 9 15,942,469 (GRCm39) missense probably damaging 1.00
R4721:Fat3 UTSW 9 15,941,262 (GRCm39) missense probably damaging 1.00
R4790:Fat3 UTSW 9 15,909,780 (GRCm39) missense probably damaging 1.00
R4796:Fat3 UTSW 9 15,911,028 (GRCm39) missense probably benign 0.17
R4823:Fat3 UTSW 9 15,907,803 (GRCm39) missense probably benign
R4836:Fat3 UTSW 9 16,289,019 (GRCm39) missense probably damaging 1.00
R4842:Fat3 UTSW 9 15,908,883 (GRCm39) missense probably damaging 1.00
R4849:Fat3 UTSW 9 16,289,244 (GRCm39) missense probably benign 0.03
R4856:Fat3 UTSW 9 15,932,626 (GRCm39) missense probably benign
R4869:Fat3 UTSW 9 16,288,773 (GRCm39) missense probably damaging 0.98
R4886:Fat3 UTSW 9 15,932,626 (GRCm39) missense probably benign
R4899:Fat3 UTSW 9 15,881,095 (GRCm39) missense probably damaging 1.00
R4986:Fat3 UTSW 9 15,909,636 (GRCm39) missense probably damaging 1.00
R5058:Fat3 UTSW 9 15,908,154 (GRCm39) missense probably damaging 1.00
R5079:Fat3 UTSW 9 15,910,423 (GRCm39) missense probably benign 0.01
R5080:Fat3 UTSW 9 15,910,634 (GRCm39) missense probably benign 0.35
R5174:Fat3 UTSW 9 15,910,866 (GRCm39) missense probably damaging 1.00
R5183:Fat3 UTSW 9 15,871,609 (GRCm39) missense probably damaging 0.99
R5203:Fat3 UTSW 9 16,289,438 (GRCm39) missense possibly damaging 0.79
R5216:Fat3 UTSW 9 16,288,833 (GRCm39) missense probably damaging 1.00
R5230:Fat3 UTSW 9 15,901,856 (GRCm39) missense possibly damaging 0.51
R5318:Fat3 UTSW 9 16,287,925 (GRCm39) missense probably damaging 1.00
R5377:Fat3 UTSW 9 16,287,739 (GRCm39) missense probably benign 0.05
R5385:Fat3 UTSW 9 15,833,971 (GRCm39) missense possibly damaging 0.82
R5436:Fat3 UTSW 9 15,871,810 (GRCm39) missense probably benign 0.02
R5437:Fat3 UTSW 9 15,996,604 (GRCm39) missense probably damaging 1.00
R5453:Fat3 UTSW 9 15,908,160 (GRCm39) missense probably damaging 1.00
R5460:Fat3 UTSW 9 15,830,463 (GRCm39) missense probably damaging 1.00
R5516:Fat3 UTSW 9 15,910,005 (GRCm39) missense probably damaging 1.00
R5568:Fat3 UTSW 9 16,288,219 (GRCm39) nonsense probably null
R5628:Fat3 UTSW 9 15,877,392 (GRCm39) missense probably damaging 1.00
R5835:Fat3 UTSW 9 16,287,129 (GRCm39) missense probably damaging 1.00
R5845:Fat3 UTSW 9 16,288,506 (GRCm39) missense probably damaging 1.00
R5898:Fat3 UTSW 9 15,849,757 (GRCm39) missense probably benign 0.15
R5941:Fat3 UTSW 9 15,910,797 (GRCm39) missense probably benign 0.07
R5974:Fat3 UTSW 9 15,917,824 (GRCm39) critical splice donor site probably null
R5986:Fat3 UTSW 9 15,909,613 (GRCm39) missense probably benign 0.22
R6015:Fat3 UTSW 9 16,287,346 (GRCm39) missense possibly damaging 0.55
R6031:Fat3 UTSW 9 15,899,788 (GRCm39) missense probably benign 0.02
R6031:Fat3 UTSW 9 15,899,788 (GRCm39) missense probably benign 0.02
R6042:Fat3 UTSW 9 16,289,113 (GRCm39) missense probably benign 0.12
R6051:Fat3 UTSW 9 16,286,751 (GRCm39) missense possibly damaging 0.83
R6052:Fat3 UTSW 9 15,833,975 (GRCm39) missense probably null
R6119:Fat3 UTSW 9 16,287,864 (GRCm39) missense possibly damaging 0.82
R6161:Fat3 UTSW 9 16,288,818 (GRCm39) missense probably damaging 1.00
R6254:Fat3 UTSW 9 15,907,441 (GRCm39) missense probably benign 0.19
R6318:Fat3 UTSW 9 15,828,280 (GRCm39) intron probably benign
R6347:Fat3 UTSW 9 15,909,668 (GRCm39) missense probably damaging 1.00
R6348:Fat3 UTSW 9 15,849,287 (GRCm39) critical splice donor site probably null
R6351:Fat3 UTSW 9 15,849,694 (GRCm39) missense probably damaging 1.00
R6450:Fat3 UTSW 9 15,910,466 (GRCm39) missense possibly damaging 0.51
R6460:Fat3 UTSW 9 15,878,296 (GRCm39) missense probably damaging 1.00
R6524:Fat3 UTSW 9 15,903,552 (GRCm39) missense probably damaging 1.00
R6533:Fat3 UTSW 9 15,910,195 (GRCm39) missense probably benign 0.02
R6565:Fat3 UTSW 9 15,826,623 (GRCm39) missense probably benign
R6576:Fat3 UTSW 9 16,288,506 (GRCm39) missense probably damaging 1.00
R6649:Fat3 UTSW 9 16,288,038 (GRCm39) missense probably damaging 1.00
R6716:Fat3 UTSW 9 15,830,565 (GRCm39) missense probably benign
R6719:Fat3 UTSW 9 15,907,440 (GRCm39) missense probably benign
R6753:Fat3 UTSW 9 15,826,357 (GRCm39) missense possibly damaging 0.82
R6754:Fat3 UTSW 9 15,826,357 (GRCm39) missense possibly damaging 0.82
R6755:Fat3 UTSW 9 15,826,357 (GRCm39) missense possibly damaging 0.82
R6792:Fat3 UTSW 9 16,286,940 (GRCm39) missense probably damaging 1.00
R6802:Fat3 UTSW 9 15,826,357 (GRCm39) missense possibly damaging 0.82
R6803:Fat3 UTSW 9 15,908,083 (GRCm39) missense probably damaging 0.99
R6831:Fat3 UTSW 9 16,287,847 (GRCm39) missense probably damaging 0.98
R6831:Fat3 UTSW 9 15,826,357 (GRCm39) missense possibly damaging 0.82
R6833:Fat3 UTSW 9 15,826,357 (GRCm39) missense possibly damaging 0.82
R6877:Fat3 UTSW 9 15,910,564 (GRCm39) missense probably benign
R6894:Fat3 UTSW 9 15,909,072 (GRCm39) missense probably damaging 1.00
R6915:Fat3 UTSW 9 16,289,044 (GRCm39) missense probably benign 0.37
R6931:Fat3 UTSW 9 15,871,238 (GRCm39) missense possibly damaging 0.89
R6934:Fat3 UTSW 9 16,288,252 (GRCm39) missense probably damaging 0.98
R6940:Fat3 UTSW 9 15,828,096 (GRCm39) splice site probably null
R6959:Fat3 UTSW 9 15,908,181 (GRCm39) missense possibly damaging 0.91
R6969:Fat3 UTSW 9 15,941,212 (GRCm39) missense probably benign 0.29
R6986:Fat3 UTSW 9 15,932,631 (GRCm39) missense probably damaging 1.00
R6993:Fat3 UTSW 9 15,830,517 (GRCm39) missense probably damaging 1.00
R7039:Fat3 UTSW 9 16,287,561 (GRCm39) missense probably damaging 1.00
R7051:Fat3 UTSW 9 16,289,123 (GRCm39) missense probably damaging 1.00
R7089:Fat3 UTSW 9 15,908,214 (GRCm39) missense probably benign 0.01
R7136:Fat3 UTSW 9 16,289,481 (GRCm39) missense probably benign
R7137:Fat3 UTSW 9 15,908,444 (GRCm39) missense probably damaging 1.00
R7154:Fat3 UTSW 9 15,908,160 (GRCm39) missense probably damaging 1.00
R7170:Fat3 UTSW 9 15,917,870 (GRCm39) missense probably damaging 0.99
R7183:Fat3 UTSW 9 15,834,133 (GRCm39) missense possibly damaging 0.81
R7237:Fat3 UTSW 9 16,288,510 (GRCm39) missense probably damaging 1.00
R7288:Fat3 UTSW 9 15,909,888 (GRCm39) missense probably damaging 1.00
R7293:Fat3 UTSW 9 15,826,592 (GRCm39) missense
R7293:Fat3 UTSW 9 15,826,336 (GRCm39) missense
R7381:Fat3 UTSW 9 16,158,283 (GRCm39) missense probably damaging 1.00
R7438:Fat3 UTSW 9 15,899,778 (GRCm39) missense probably benign
R7537:Fat3 UTSW 9 15,849,615 (GRCm39) missense probably damaging 1.00
R7560:Fat3 UTSW 9 15,908,138 (GRCm39) missense probably damaging 1.00
R7585:Fat3 UTSW 9 15,909,558 (GRCm39) missense probably benign 0.03
R7623:Fat3 UTSW 9 15,899,620 (GRCm39) missense probably damaging 1.00
R7624:Fat3 UTSW 9 15,871,165 (GRCm39) missense possibly damaging 0.72
R7684:Fat3 UTSW 9 15,899,564 (GRCm39) critical splice donor site probably null
R7690:Fat3 UTSW 9 15,909,477 (GRCm39) missense probably damaging 1.00
R7804:Fat3 UTSW 9 15,901,888 (GRCm39) missense probably benign 0.01
R7809:Fat3 UTSW 9 15,917,924 (GRCm39) missense probably damaging 1.00
R7924:Fat3 UTSW 9 15,910,593 (GRCm39) missense probably damaging 1.00
R7925:Fat3 UTSW 9 15,942,656 (GRCm39) missense possibly damaging 0.77
R7954:Fat3 UTSW 9 15,909,708 (GRCm39) missense probably damaging 1.00
R8021:Fat3 UTSW 9 15,910,405 (GRCm39) missense probably damaging 0.99
R8118:Fat3 UTSW 9 15,871,400 (GRCm39) missense probably benign
R8141:Fat3 UTSW 9 15,908,362 (GRCm39) missense possibly damaging 0.79
R8163:Fat3 UTSW 9 15,871,055 (GRCm39) missense probably damaging 1.00
R8170:Fat3 UTSW 9 15,858,792 (GRCm39) missense probably damaging 0.97
R8201:Fat3 UTSW 9 15,908,773 (GRCm39) missense possibly damaging 0.93
R8258:Fat3 UTSW 9 15,901,887 (GRCm39) missense possibly damaging 0.79
R8259:Fat3 UTSW 9 15,901,887 (GRCm39) missense possibly damaging 0.79
R8274:Fat3 UTSW 9 16,288,786 (GRCm39) nonsense probably null
R8275:Fat3 UTSW 9 16,158,046 (GRCm39) missense probably damaging 1.00
R8345:Fat3 UTSW 9 15,910,570 (GRCm39) missense probably benign 0.08
R8350:Fat3 UTSW 9 15,826,435 (GRCm39) missense
R8405:Fat3 UTSW 9 15,907,167 (GRCm39) missense probably damaging 1.00
R8421:Fat3 UTSW 9 15,909,480 (GRCm39) missense probably damaging 1.00
R8450:Fat3 UTSW 9 15,826,435 (GRCm39) missense
R8472:Fat3 UTSW 9 16,286,563 (GRCm39) missense possibly damaging 0.90
R8482:Fat3 UTSW 9 16,158,263 (GRCm39) missense probably benign 0.02
R8680:Fat3 UTSW 9 15,908,703 (GRCm39) missense probably damaging 0.99
R8690:Fat3 UTSW 9 15,878,397 (GRCm39) missense probably benign 0.45
R8748:Fat3 UTSW 9 15,834,161 (GRCm39) missense possibly damaging 0.70
R8756:Fat3 UTSW 9 16,287,885 (GRCm39) missense probably damaging 1.00
R8834:Fat3 UTSW 9 15,942,493 (GRCm39) missense probably damaging 1.00
R8848:Fat3 UTSW 9 15,878,398 (GRCm39) missense probably damaging 1.00
R8884:Fat3 UTSW 9 15,941,280 (GRCm39) missense probably damaging 1.00
R8898:Fat3 UTSW 9 15,858,822 (GRCm39) missense probably benign 0.04
R8930:Fat3 UTSW 9 15,910,819 (GRCm39) missense probably benign 0.06
R8932:Fat3 UTSW 9 15,910,819 (GRCm39) missense probably benign 0.06
R8954:Fat3 UTSW 9 16,287,864 (GRCm39) missense probably benign 0.00
R8995:Fat3 UTSW 9 16,286,898 (GRCm39) missense probably damaging 1.00
R9000:Fat3 UTSW 9 15,918,095 (GRCm39) missense probably benign 0.12
R9000:Fat3 UTSW 9 15,871,816 (GRCm39) missense possibly damaging 0.82
R9060:Fat3 UTSW 9 15,910,782 (GRCm39) missense possibly damaging 0.80
R9116:Fat3 UTSW 9 15,909,421 (GRCm39) missense probably benign 0.34
R9136:Fat3 UTSW 9 15,833,738 (GRCm39) missense
R9193:Fat3 UTSW 9 15,910,248 (GRCm39) missense probably benign
R9235:Fat3 UTSW 9 15,833,674 (GRCm39) missense probably null
R9257:Fat3 UTSW 9 15,907,863 (GRCm39) missense probably benign
R9297:Fat3 UTSW 9 15,908,996 (GRCm39) missense probably damaging 1.00
R9307:Fat3 UTSW 9 15,932,719 (GRCm39) missense probably damaging 1.00
R9412:Fat3 UTSW 9 15,908,703 (GRCm39) missense probably damaging 0.99
R9427:Fat3 UTSW 9 16,288,691 (GRCm39) nonsense probably null
R9430:Fat3 UTSW 9 16,287,381 (GRCm39) missense probably damaging 1.00
R9480:Fat3 UTSW 9 15,942,703 (GRCm39) missense probably damaging 1.00
R9497:Fat3 UTSW 9 15,903,504 (GRCm39) missense probably damaging 0.99
R9547:Fat3 UTSW 9 15,911,142 (GRCm39) missense possibly damaging 0.86
R9569:Fat3 UTSW 9 15,830,495 (GRCm39) missense
R9591:Fat3 UTSW 9 16,288,336 (GRCm39) missense probably benign 0.01
R9615:Fat3 UTSW 9 16,289,343 (GRCm39) missense probably benign 0.00
R9649:Fat3 UTSW 9 15,908,054 (GRCm39) missense possibly damaging 0.57
R9671:Fat3 UTSW 9 16,286,871 (GRCm39) missense possibly damaging 0.93
R9750:Fat3 UTSW 9 15,915,157 (GRCm39) missense probably benign 0.00
R9777:Fat3 UTSW 9 15,826,537 (GRCm39) missense probably benign
RF006:Fat3 UTSW 9 15,909,913 (GRCm39) missense probably benign 0.36
X0021:Fat3 UTSW 9 15,941,227 (GRCm39) missense probably null 0.66
X0026:Fat3 UTSW 9 15,907,629 (GRCm39) missense probably benign
X0064:Fat3 UTSW 9 15,830,573 (GRCm39) missense probably benign
Z1176:Fat3 UTSW 9 16,286,913 (GRCm39) missense probably benign
Z1176:Fat3 UTSW 9 16,286,725 (GRCm39) missense probably damaging 1.00
Z1176:Fat3 UTSW 9 15,858,822 (GRCm39) missense probably damaging 0.98
Z1177:Fat3 UTSW 9 15,877,287 (GRCm39) missense possibly damaging 0.68
Z1177:Fat3 UTSW 9 15,858,834 (GRCm39) missense probably damaging 1.00
Z1177:Fat3 UTSW 9 15,834,322 (GRCm39) missense possibly damaging 0.81
Z1177:Fat3 UTSW 9 15,881,131 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTATGTTGAACCTCCCAAGACC -3'
(R):5'- GGATCCTGACCTTGGATTGG -3'

Sequencing Primer
(F):5'- CACTGCCATCTCTGATAGAGTACTGG -3'
(R):5'- GGGGGTCAAGTACGTTACTC -3'
Posted On 2016-04-27