Incidental Mutation 'R4941:Or8g54'
ID 383108
Institutional Source Beutler Lab
Gene Symbol Or8g54
Ensembl Gene ENSMUSG00000094254
Gene Name olfactory receptor family 8 subfamily G member 54
Synonyms MOR171-7, Olfr969, GA_x6K02T2PVTD-33492981-33493916
MMRRC Submission 042539-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R4941 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 39706673-39707608 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39707160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 163 (M163T)
Ref Sequence ENSEMBL: ENSMUSP00000149551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074566] [ENSMUST00000213266]
AlphaFold Q8VG89
Predicted Effect possibly damaging
Transcript: ENSMUST00000074566
AA Change: M163T

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074151
Gene: ENSMUSG00000094254
AA Change: M163T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-50 PFAM
Pfam:7tm_1 41 290 2.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213266
AA Change: M163T

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,112,529 (GRCm39) I85F probably damaging Het
Abcc6 T A 7: 45,661,947 (GRCm39) I435F probably benign Het
Adam3 T C 8: 25,167,332 (GRCm39) probably benign Het
Adrb3 T C 8: 27,717,450 (GRCm39) Y333C probably damaging Het
Ago4 A T 4: 126,419,847 (GRCm39) D43E probably benign Het
Agt T A 8: 125,283,727 (GRCm39) Q464L probably benign Het
Amdhd1 A T 10: 93,367,463 (GRCm39) D230E probably damaging Het
Aplf A G 6: 87,645,405 (GRCm39) I33T probably damaging Het
Aplf A T 6: 87,623,331 (GRCm39) N249K probably benign Het
Arap2 A G 5: 62,906,821 (GRCm39) M66T probably benign Het
Atf4 T C 15: 80,140,434 (GRCm39) probably benign Het
Bahcc1 A C 11: 120,177,491 (GRCm39) H2068P probably benign Het
Bcor C T X: 11,906,725 (GRCm39) R1551Q probably damaging Het
Bltp1 A C 3: 36,971,851 (GRCm39) H528P probably damaging Het
Bltp1 G A 3: 36,974,050 (GRCm39) S600N probably benign Het
Catsper1 C A 19: 5,391,466 (GRCm39) A616D possibly damaging Het
Cdkn3 A G 14: 47,007,320 (GRCm39) D159G possibly damaging Het
Cep162 T C 9: 87,108,022 (GRCm39) probably benign Het
Clca3a1 T A 3: 144,721,414 (GRCm39) I386L probably damaging Het
Cldn10 G A 14: 119,025,725 (GRCm39) G53S possibly damaging Het
Cmtm3 T C 8: 105,070,460 (GRCm39) L73P probably damaging Het
Cnksr3 A C 10: 7,102,925 (GRCm39) L149R probably benign Het
Cope T C 8: 70,755,584 (GRCm39) probably null Het
Cpa6 T A 1: 10,479,562 (GRCm39) M224L probably benign Het
Cyp2d41-ps T C 15: 82,666,154 (GRCm39) noncoding transcript Het
Ddx55 T A 5: 124,706,779 (GRCm39) L592* probably null Het
Deup1 T C 9: 15,499,323 (GRCm39) M333V probably benign Het
Eif4a1 T C 11: 69,558,640 (GRCm39) probably benign Het
Eif4g3 A C 4: 137,897,876 (GRCm39) D1026A probably damaging Het
Eif5b T C 1: 38,090,280 (GRCm39) V1153A probably damaging Het
Ercc8 G T 13: 108,297,301 (GRCm39) probably benign Het
Fam227a C A 15: 79,524,204 (GRCm39) probably null Het
Fat1 A G 8: 45,489,312 (GRCm39) I3505V probably benign Het
Fat3 T G 9: 16,286,448 (GRCm39) E1025A probably damaging Het
Fat4 C T 3: 39,011,601 (GRCm39) R2234W probably damaging Het
Fer1l4 G T 2: 155,887,009 (GRCm39) F634L probably damaging Het
Fetub G A 16: 22,756,624 (GRCm39) V162I probably benign Het
Fgd4 T C 16: 16,302,402 (GRCm39) Q51R probably benign Het
Fgfr2 T C 7: 129,800,175 (GRCm39) H140R probably benign Het
Flt3 T A 5: 147,293,185 (GRCm39) probably null Het
Gabrb1 A G 5: 72,294,121 (GRCm39) N465S probably damaging Het
Gapdhs T C 7: 30,432,691 (GRCm39) I206V probably benign Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Glp2r T C 11: 67,637,529 (GRCm39) probably null Het
Gm4956 T A 1: 21,368,306 (GRCm39) noncoding transcript Het
Gtf2a1l A T 17: 89,022,350 (GRCm39) D447V probably damaging Het
Hsd3b5 A G 3: 98,526,379 (GRCm39) W356R probably damaging Het
Idh2 A T 7: 79,745,847 (GRCm39) V335D probably damaging Het
Isyna1 T C 8: 71,048,146 (GRCm39) I184T probably damaging Het
Kcnh2 A G 5: 24,536,085 (GRCm39) S320P probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kpna6 A G 4: 129,541,825 (GRCm39) F524S probably damaging Het
Lap3 A T 5: 45,663,539 (GRCm39) M338L probably benign Het
Lins1 T C 7: 66,359,198 (GRCm39) probably benign Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lrrc43 A G 5: 123,639,126 (GRCm39) D385G probably benign Het
Maf T C 8: 116,433,532 (GRCm39) D24G unknown Het
Nell1 T C 7: 49,712,386 (GRCm39) S69P probably benign Het
Nkapd1 G T 9: 50,518,809 (GRCm39) Q268K probably benign Het
Or13p4 C T 4: 118,547,089 (GRCm39) V187I possibly damaging Het
Or2h1 C T 17: 37,404,484 (GRCm39) G94E probably damaging Het
Or2j6 T A 7: 139,980,792 (GRCm39) M56L probably benign Het
Or51af1 T C 7: 103,141,458 (GRCm39) D209G probably damaging Het
Or5an10 A G 19: 12,276,260 (GRCm39) S79P possibly damaging Het
Oxld1 T C 11: 120,347,862 (GRCm39) T112A probably benign Het
Parp14 T C 16: 35,666,403 (GRCm39) N1210S probably benign Het
Pcdhb10 C A 18: 37,545,887 (GRCm39) T321K probably benign Het
Pcdhb8 C T 18: 37,489,059 (GRCm39) L246F probably benign Het
Pcdhga1 T A 18: 37,795,659 (GRCm39) I221K probably benign Het
Pcdhga9 T A 18: 37,871,185 (GRCm39) V338E probably damaging Het
Pdcd11 T C 19: 47,108,325 (GRCm39) S1231P probably damaging Het
Pde6c A T 19: 38,140,013 (GRCm39) L325F probably damaging Het
Pnpla7 T A 2: 24,887,276 (GRCm39) probably null Het
Pparg T A 6: 115,467,071 (GRCm39) V478E probably damaging Het
Ppib T C 9: 65,967,672 (GRCm39) V42A probably benign Het
Ppox T C 1: 171,105,166 (GRCm39) M341V probably damaging Het
Proc T C 18: 32,258,166 (GRCm39) K260E possibly damaging Het
Ptpro C T 6: 137,369,763 (GRCm39) P525L probably damaging Het
Rnf14 C A 18: 38,441,435 (GRCm39) A275E probably damaging Het
Scnn1b C T 7: 121,511,231 (GRCm39) P306L probably damaging Het
Sec14l5 A G 16: 4,994,364 (GRCm39) E386G probably damaging Het
Sftpa1 T A 14: 40,854,509 (GRCm39) I32N probably damaging Het
Slc26a5 A G 5: 22,025,384 (GRCm39) I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 (GRCm39) Y438C probably damaging Het
Spire1 T C 18: 67,652,384 (GRCm39) E231G possibly damaging Het
Stab1 T A 14: 30,873,528 (GRCm39) I1014F probably benign Het
Steap2 T C 5: 5,727,651 (GRCm39) Y228C probably damaging Het
Tmem131l T C 3: 83,806,546 (GRCm39) T1487A probably benign Het
Tmem171 A G 13: 98,828,803 (GRCm39) F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 (GRCm39) V199A probably damaging Het
Tmem45a T C 16: 56,642,652 (GRCm39) N173S possibly damaging Het
Uqcrc2 C T 7: 120,242,301 (GRCm39) R148C probably benign Het
Vmn2r116 A G 17: 23,620,116 (GRCm39) K617E probably damaging Het
Xrcc6 T C 15: 81,924,013 (GRCm39) L229P probably damaging Het
Yju2 A G 17: 56,271,149 (GRCm39) D97G possibly damaging Het
Zfp184 A G 13: 22,133,891 (GRCm39) D46G probably damaging Het
Zfp790 T A 7: 29,528,916 (GRCm39) C534S possibly damaging Het
Zfp990 A T 4: 145,263,407 (GRCm39) N135I probably damaging Het
Other mutations in Or8g54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Or8g54 APN 9 39,706,674 (GRCm39) start codon destroyed probably null 1.00
IGL02108:Or8g54 APN 9 39,706,808 (GRCm39) missense probably damaging 0.99
IGL02999:Or8g54 APN 9 39,706,752 (GRCm39) missense probably damaging 1.00
IGL03089:Or8g54 APN 9 39,706,977 (GRCm39) missense probably benign 0.18
IGL03107:Or8g54 APN 9 39,707,475 (GRCm39) missense probably benign 0.03
R1232:Or8g54 UTSW 9 39,707,264 (GRCm39) missense probably benign 0.18
R1682:Or8g54 UTSW 9 39,706,954 (GRCm39) nonsense probably null
R1796:Or8g54 UTSW 9 39,707,301 (GRCm39) missense possibly damaging 0.82
R2152:Or8g54 UTSW 9 39,706,943 (GRCm39) missense probably benign 0.01
R4534:Or8g54 UTSW 9 39,707,296 (GRCm39) missense probably benign 0.00
R5239:Or8g54 UTSW 9 39,707,492 (GRCm39) missense probably damaging 0.99
R5602:Or8g54 UTSW 9 39,707,490 (GRCm39) missense possibly damaging 0.94
R6681:Or8g54 UTSW 9 39,706,710 (GRCm39) missense probably benign 0.02
R6819:Or8g54 UTSW 9 39,706,905 (GRCm39) missense probably benign 0.00
R7066:Or8g54 UTSW 9 39,707,420 (GRCm39) missense probably benign 0.00
R7138:Or8g54 UTSW 9 39,707,086 (GRCm39) nonsense probably null
R8995:Or8g54 UTSW 9 39,707,313 (GRCm39) missense possibly damaging 0.52
R9446:Or8g54 UTSW 9 39,707,342 (GRCm39) missense probably damaging 1.00
Z1176:Or8g54 UTSW 9 39,707,225 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTGAATGCATGACTCAGC -3'
(R):5'- CCTGCCTTCAGTGGATTTAATC -3'

Sequencing Primer
(F):5'- TGAATGCATGACTCAGCTCTAC -3'
(R):5'- TGCTGGCTATGATGAAGATGTAAG -3'
Posted On 2016-04-27