Incidental Mutation 'R4941:Stab1'
ID 383126
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Name stabilin 1
Synonyms MS-1
MMRRC Submission 042539-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4941 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 31139013-31168641 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31151571 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1014 (I1014F)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036618
AA Change: I1014F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: I1014F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,917,702 H528P probably damaging Het
4932438A13Rik G A 3: 36,919,901 S600N probably benign Het
A4galt T A 15: 83,228,328 I85F probably damaging Het
Abcc6 T A 7: 46,012,523 I435F probably benign Het
Adam3 T C 8: 24,677,316 probably benign Het
Adrb3 T C 8: 27,227,422 Y333C probably damaging Het
Ago4 A T 4: 126,526,054 D43E probably benign Het
Agt T A 8: 124,556,988 Q464L probably benign Het
Amdhd1 A T 10: 93,531,601 D230E probably damaging Het
Aplf A T 6: 87,646,349 N249K probably benign Het
Aplf A G 6: 87,668,423 I33T probably damaging Het
Arap2 A G 5: 62,749,478 M66T probably benign Het
Atf4 T C 15: 80,256,233 probably benign Het
AU019823 G T 9: 50,607,509 Q268K probably benign Het
Bahcc1 A C 11: 120,286,665 H2068P probably benign Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Catsper1 C A 19: 5,341,438 A616D possibly damaging Het
Ccdc94 A G 17: 55,964,149 D97G possibly damaging Het
Cdkn3 A G 14: 46,769,863 D159G possibly damaging Het
Cep162 T C 9: 87,225,969 probably benign Het
Clca1 T A 3: 145,015,653 I386L probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cmtm3 T C 8: 104,343,828 L73P probably damaging Het
Cnksr3 A C 10: 7,152,925 L149R probably benign Het
Cope T C 8: 70,302,934 probably null Het
Cpa6 T A 1: 10,409,337 M224L probably benign Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Ddx55 T A 5: 124,568,716 L592* probably null Het
Deup1 T C 9: 15,588,027 M333V probably benign Het
Eif4a1 T C 11: 69,667,814 probably benign Het
Eif4g3 A C 4: 138,170,565 D1026A probably damaging Het
Eif5b T C 1: 38,051,199 V1153A probably damaging Het
Ercc8 G T 13: 108,160,767 probably benign Het
Fam227a C A 15: 79,640,003 probably null Het
Fat1 A G 8: 45,036,275 I3505V probably benign Het
Fat3 T G 9: 16,375,152 E1025A probably damaging Het
Fat4 C T 3: 38,957,452 R2234W probably damaging Het
Fer1l4 G T 2: 156,045,089 F634L probably damaging Het
Fetub G A 16: 22,937,874 V162I probably benign Het
Fgd4 T C 16: 16,484,538 Q51R probably benign Het
Fgfr2 T C 7: 130,198,445 H140R probably benign Het
Flt3 T A 5: 147,356,375 probably null Het
Gabrb1 A G 5: 72,136,778 N465S probably damaging Het
Gapdhs T C 7: 30,733,266 I206V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Glp2r T C 11: 67,746,703 probably null Het
Gm4956 T A 1: 21,298,082 noncoding transcript Het
Gtf2a1l A T 17: 88,714,922 D447V probably damaging Het
Hsd3b5 A G 3: 98,619,063 W356R probably damaging Het
Idh2 A T 7: 80,096,099 V335D probably damaging Het
Isyna1 T C 8: 70,595,496 I184T probably damaging Het
Kcnh2 A G 5: 24,331,087 S320P probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kpna6 A G 4: 129,648,032 F524S probably damaging Het
Lap3 A T 5: 45,506,197 M338L probably benign Het
Lins1 T C 7: 66,709,450 probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc43 A G 5: 123,501,063 D385G probably benign Het
Maf T C 8: 115,706,793 D24G unknown Het
Nell1 T C 7: 50,062,638 S69P probably benign Het
Olfr1342 C T 4: 118,689,892 V187I possibly damaging Het
Olfr1436 A G 19: 12,298,896 S79P possibly damaging Het
Olfr531 T A 7: 140,400,879 M56L probably benign Het
Olfr609 T C 7: 103,492,251 D209G probably damaging Het
Olfr91 C T 17: 37,093,592 G94E probably damaging Het
Olfr969 T C 9: 39,795,864 M163T possibly damaging Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Parp14 T C 16: 35,846,033 N1210S probably benign Het
Pcdhb10 C A 18: 37,412,834 T321K probably benign Het
Pcdhb8 C T 18: 37,356,006 L246F probably benign Het
Pcdhga1 T A 18: 37,662,606 I221K probably benign Het
Pcdhga9 T A 18: 37,738,132 V338E probably damaging Het
Pdcd11 T C 19: 47,119,886 S1231P probably damaging Het
Pde6c A T 19: 38,151,565 L325F probably damaging Het
Pnpla7 T A 2: 24,997,264 probably null Het
Pparg T A 6: 115,490,110 V478E probably damaging Het
Ppib T C 9: 66,060,390 V42A probably benign Het
Ppox T C 1: 171,277,593 M341V probably damaging Het
Proc T C 18: 32,125,113 K260E possibly damaging Het
Ptpro C T 6: 137,392,765 P525L probably damaging Het
Rnf14 C A 18: 38,308,382 A275E probably damaging Het
Scnn1b C T 7: 121,912,008 P306L probably damaging Het
Sec14l5 A G 16: 5,176,500 E386G probably damaging Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc26a5 A G 5: 21,820,386 I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 Y438C probably damaging Het
Spire1 T C 18: 67,519,314 E231G possibly damaging Het
Steap2 T C 5: 5,677,651 Y228C probably damaging Het
Tmem131l T C 3: 83,899,239 T1487A probably benign Het
Tmem171 A G 13: 98,692,295 F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 V199A probably damaging Het
Tmem45a T C 16: 56,822,289 N173S possibly damaging Het
Uqcrc2 C T 7: 120,643,078 R148C probably benign Het
Vmn2r116 A G 17: 23,401,142 K617E probably damaging Het
Xrcc6 T C 15: 82,039,812 L229P probably damaging Het
Zfp184 A G 13: 21,949,721 D46G probably damaging Het
Zfp790 T A 7: 29,829,491 C534S possibly damaging Het
Zfp990 A T 4: 145,536,837 N135I probably damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31,161,357 (GRCm38) missense probably benign 0.01
IGL00323:Stab1 APN 14 31,139,306 (GRCm38) missense probably benign 0.04
IGL00515:Stab1 APN 14 31,159,729 (GRCm38) missense probably benign 0.20
IGL00844:Stab1 APN 14 31,147,066 (GRCm38) missense probably damaging 1.00
IGL01374:Stab1 APN 14 31,147,075 (GRCm38) missense probably damaging 1.00
IGL01384:Stab1 APN 14 31,150,408 (GRCm38) missense probably benign
IGL01431:Stab1 APN 14 31,148,995 (GRCm38) missense probably benign 0.06
IGL01787:Stab1 APN 14 31,139,808 (GRCm38) missense probably damaging 1.00
IGL02128:Stab1 APN 14 31,150,441 (GRCm38) missense probably damaging 1.00
IGL02138:Stab1 APN 14 31,143,513 (GRCm38) critical splice donor site probably null
IGL02256:Stab1 APN 14 31,141,592 (GRCm38) missense probably damaging 1.00
IGL02340:Stab1 APN 14 31,140,410 (GRCm38) missense probably damaging 0.96
IGL02507:Stab1 APN 14 31,139,210 (GRCm38) unclassified probably benign
IGL02695:Stab1 APN 14 31,159,271 (GRCm38) missense probably damaging 1.00
IGL02755:Stab1 APN 14 31,139,638 (GRCm38) missense probably benign 0.01
IGL02870:Stab1 APN 14 31,139,397 (GRCm38) missense probably benign 0.00
IGL02884:Stab1 APN 14 31,150,143 (GRCm38) splice site probably null
IGL03035:Stab1 APN 14 31,147,769 (GRCm38) missense probably benign 0.00
IGL03267:Stab1 APN 14 31,142,729 (GRCm38) missense probably damaging 1.00
IGL03286:Stab1 APN 14 31,159,326 (GRCm38) splice site probably benign
IGL03366:Stab1 APN 14 31,150,263 (GRCm38) missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31,154,407 (GRCm38) missense probably benign 0.42
R0906_Stab1_335 UTSW 14 31,145,249 (GRCm38) missense probably benign 0.19
R5086_Stab1_467 UTSW 14 31,159,304 (GRCm38) missense probably damaging 1.00
IGL02835:Stab1 UTSW 14 31,146,024 (GRCm38) critical splice donor site probably null
K7371:Stab1 UTSW 14 31,150,249 (GRCm38) missense probably damaging 1.00
R0053:Stab1 UTSW 14 31,140,687 (GRCm38) missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31,140,687 (GRCm38) missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31,157,070 (GRCm38) splice site probably benign
R0066:Stab1 UTSW 14 31,157,070 (GRCm38) splice site probably benign
R0363:Stab1 UTSW 14 31,159,008 (GRCm38) splice site probably benign
R0387:Stab1 UTSW 14 31,148,101 (GRCm38) missense probably benign 0.00
R0391:Stab1 UTSW 14 31,143,418 (GRCm38) missense probably benign 0.21
R0513:Stab1 UTSW 14 31,148,945 (GRCm38) missense probably benign 0.08
R0546:Stab1 UTSW 14 31,139,550 (GRCm38) missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31,152,600 (GRCm38) missense probably benign 0.16
R0906:Stab1 UTSW 14 31,145,249 (GRCm38) missense probably benign 0.19
R0963:Stab1 UTSW 14 31,147,274 (GRCm38) missense probably damaging 0.97
R1219:Stab1 UTSW 14 31,140,621 (GRCm38) splice site probably null
R1234:Stab1 UTSW 14 31,150,236 (GRCm38) missense probably damaging 1.00
R1260:Stab1 UTSW 14 31,151,889 (GRCm38) missense probably damaging 1.00
R1400:Stab1 UTSW 14 31,139,830 (GRCm38) missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31,149,001 (GRCm38) missense probably benign 0.19
R1405:Stab1 UTSW 14 31,149,001 (GRCm38) missense probably benign 0.19
R1440:Stab1 UTSW 14 31,151,690 (GRCm38) nonsense probably null
R1472:Stab1 UTSW 14 31,141,586 (GRCm38) missense probably benign 0.01
R1474:Stab1 UTSW 14 31,149,861 (GRCm38) missense probably benign 0.45
R1475:Stab1 UTSW 14 31,163,828 (GRCm38) missense probably benign
R1509:Stab1 UTSW 14 31,151,584 (GRCm38) splice site probably benign
R1551:Stab1 UTSW 14 31,160,499 (GRCm38) missense probably benign 0.00
R1572:Stab1 UTSW 14 31,150,823 (GRCm38) missense probably damaging 1.00
R1633:Stab1 UTSW 14 31,150,380 (GRCm38) splice site probably null
R1719:Stab1 UTSW 14 31,146,028 (GRCm38) nonsense probably null
R1733:Stab1 UTSW 14 31,145,303 (GRCm38) missense probably damaging 1.00
R1763:Stab1 UTSW 14 31,168,416 (GRCm38) missense probably benign 0.04
R1808:Stab1 UTSW 14 31,141,144 (GRCm38) missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31,157,465 (GRCm38) missense probably benign 0.03
R1853:Stab1 UTSW 14 31,140,463 (GRCm38) missense probably damaging 1.00
R1891:Stab1 UTSW 14 31,141,330 (GRCm38) missense probably benign 0.07
R1984:Stab1 UTSW 14 31,150,648 (GRCm38) missense probably benign 0.20
R1998:Stab1 UTSW 14 31,162,153 (GRCm38) nonsense probably null
R2165:Stab1 UTSW 14 31,168,435 (GRCm38) missense probably benign 0.20
R2191:Stab1 UTSW 14 31,159,270 (GRCm38) missense probably damaging 1.00
R2191:Stab1 UTSW 14 31,142,800 (GRCm38) missense probably benign 0.03
R2233:Stab1 UTSW 14 31,161,880 (GRCm38) missense probably benign 0.08
R2303:Stab1 UTSW 14 31,146,070 (GRCm38) missense probably damaging 1.00
R2496:Stab1 UTSW 14 31,161,463 (GRCm38) missense probably damaging 1.00
R2504:Stab1 UTSW 14 31,163,040 (GRCm38) critical splice donor site probably null
R2519:Stab1 UTSW 14 31,154,872 (GRCm38) missense probably damaging 1.00
R2926:Stab1 UTSW 14 31,161,799 (GRCm38) missense probably damaging 1.00
R4025:Stab1 UTSW 14 31,154,952 (GRCm38) missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31,168,479 (GRCm38) missense probably damaging 0.98
R4258:Stab1 UTSW 14 31,154,672 (GRCm38) missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31,157,445 (GRCm38) missense probably benign 0.01
R4644:Stab1 UTSW 14 31,140,487 (GRCm38) unclassified probably benign
R4660:Stab1 UTSW 14 31,154,915 (GRCm38) missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31,141,371 (GRCm38) nonsense probably null
R4802:Stab1 UTSW 14 31,141,371 (GRCm38) nonsense probably null
R4870:Stab1 UTSW 14 31,142,043 (GRCm38) missense probably benign 0.13
R4872:Stab1 UTSW 14 31,140,393 (GRCm38) missense probably damaging 1.00
R4881:Stab1 UTSW 14 31,143,672 (GRCm38) missense probably benign 0.32
R5061:Stab1 UTSW 14 31,163,099 (GRCm38) missense probably damaging 1.00
R5086:Stab1 UTSW 14 31,159,304 (GRCm38) missense probably damaging 1.00
R5086:Stab1 UTSW 14 31,143,624 (GRCm38) missense probably damaging 1.00
R5087:Stab1 UTSW 14 31,159,304 (GRCm38) missense probably damaging 1.00
R5092:Stab1 UTSW 14 31,145,855 (GRCm38) missense probably benign 0.01
R5102:Stab1 UTSW 14 31,148,017 (GRCm38) critical splice donor site probably null
R5107:Stab1 UTSW 14 31,163,795 (GRCm38) splice site probably null
R5195:Stab1 UTSW 14 31,140,521 (GRCm38) unclassified probably benign
R5217:Stab1 UTSW 14 31,159,519 (GRCm38) missense probably benign 0.25
R5285:Stab1 UTSW 14 31,143,476 (GRCm38) unclassified probably benign
R5327:Stab1 UTSW 14 31,161,836 (GRCm38) nonsense probably null
R5647:Stab1 UTSW 14 31,157,440 (GRCm38) nonsense probably null
R5696:Stab1 UTSW 14 31,160,221 (GRCm38) missense probably benign
R5996:Stab1 UTSW 14 31,139,551 (GRCm38) missense probably benign 0.39
R6016:Stab1 UTSW 14 31,158,993 (GRCm38) missense probably damaging 1.00
R6017:Stab1 UTSW 14 31,141,544 (GRCm38) missense probably benign 0.00
R6174:Stab1 UTSW 14 31,162,519 (GRCm38) nonsense probably null
R6366:Stab1 UTSW 14 31,141,438 (GRCm38) missense probably benign 0.10
R6754:Stab1 UTSW 14 31,141,081 (GRCm38) missense probably benign
R6788:Stab1 UTSW 14 31,139,160 (GRCm38) missense probably damaging 1.00
R6898:Stab1 UTSW 14 31,158,963 (GRCm38) missense probably benign 0.00
R7124:Stab1 UTSW 14 31,160,867 (GRCm38) missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31,145,073 (GRCm38) critical splice donor site probably null
R7153:Stab1 UTSW 14 31,160,584 (GRCm38) missense probably benign 0.16
R7213:Stab1 UTSW 14 31,143,673 (GRCm38) missense probably benign
R7215:Stab1 UTSW 14 31,160,797 (GRCm38) missense possibly damaging 0.93
R7319:Stab1 UTSW 14 31,140,826 (GRCm38) missense probably damaging 1.00
R7389:Stab1 UTSW 14 31,147,239 (GRCm38) missense probably benign 0.00
R7400:Stab1 UTSW 14 31,157,384 (GRCm38) missense probably null 1.00
R7427:Stab1 UTSW 14 31,159,259 (GRCm38) missense probably benign 0.00
R7428:Stab1 UTSW 14 31,159,259 (GRCm38) missense probably benign 0.00
R7484:Stab1 UTSW 14 31,160,317 (GRCm38) missense probably benign 0.00
R7568:Stab1 UTSW 14 31,152,595 (GRCm38) missense probably damaging 1.00
R7574:Stab1 UTSW 14 31,154,665 (GRCm38) missense probably benign
R7619:Stab1 UTSW 14 31,145,237 (GRCm38) missense probably benign
R7623:Stab1 UTSW 14 31,140,621 (GRCm38) missense probably benign 0.03
R7721:Stab1 UTSW 14 31,141,456 (GRCm38) missense possibly damaging 0.48
R7869:Stab1 UTSW 14 31,154,472 (GRCm38) missense probably benign 0.01
R7936:Stab1 UTSW 14 31,157,415 (GRCm38) missense possibly damaging 0.88
R7956:Stab1 UTSW 14 31,160,024 (GRCm38) missense probably benign 0.02
R7973:Stab1 UTSW 14 31,159,633 (GRCm38) critical splice donor site probably null
R8059:Stab1 UTSW 14 31,160,241 (GRCm38) missense probably benign 0.02
R8116:Stab1 UTSW 14 31,158,953 (GRCm38) missense possibly damaging 0.80
R8304:Stab1 UTSW 14 31,148,954 (GRCm38) missense probably benign 0.14
R8368:Stab1 UTSW 14 31,148,411 (GRCm38) missense possibly damaging 0.91
R8495:Stab1 UTSW 14 31,155,833 (GRCm38) missense probably damaging 1.00
R8513:Stab1 UTSW 14 31,149,790 (GRCm38) critical splice donor site probably null
R8544:Stab1 UTSW 14 31,163,051 (GRCm38) nonsense probably null
R8671:Stab1 UTSW 14 31,157,408 (GRCm38) missense probably damaging 1.00
R8885:Stab1 UTSW 14 31,161,814 (GRCm38) missense possibly damaging 0.79
R8974:Stab1 UTSW 14 31,160,822 (GRCm38) missense probably benign
R9022:Stab1 UTSW 14 31,160,269 (GRCm38) missense probably benign 0.01
R9059:Stab1 UTSW 14 31,154,848 (GRCm38) missense probably benign 0.01
R9226:Stab1 UTSW 14 31,145,855 (GRCm38) missense probably benign 0.00
R9272:Stab1 UTSW 14 31,145,341 (GRCm38) missense probably benign 0.05
R9388:Stab1 UTSW 14 31,154,355 (GRCm38) missense probably damaging 1.00
R9401:Stab1 UTSW 14 31,161,112 (GRCm38) missense probably benign
R9433:Stab1 UTSW 14 31,143,574 (GRCm38) missense probably benign 0.00
R9450:Stab1 UTSW 14 31,162,939 (GRCm38) missense possibly damaging 0.62
R9505:Stab1 UTSW 14 31,155,765 (GRCm38) missense probably damaging 1.00
R9570:Stab1 UTSW 14 31,142,681 (GRCm38) missense probably benign 0.01
R9624:Stab1 UTSW 14 31,141,388 (GRCm38) missense
R9694:Stab1 UTSW 14 31,154,944 (GRCm38) missense probably benign 0.06
R9723:Stab1 UTSW 14 31,163,891 (GRCm38) missense probably benign 0.10
X0026:Stab1 UTSW 14 31,162,191 (GRCm38) missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 31,150,660 (GRCm38) missense probably benign 0.00
Z1176:Stab1 UTSW 14 31,142,038 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCCTTCAGCATGGGTTTTCC -3'
(R):5'- TCTGCCCCTTTAGGAACTGGAG -3'

Sequencing Primer
(F):5'- TCTGAGAAGGGTCCAAGGTCCTAC -3'
(R):5'- CCCTTTAGGAACTGGAGGCAAATG -3'
Posted On 2016-04-27