Incidental Mutation 'R0320:Nrip1'
ID38313
Institutional Source Beutler Lab
Gene Symbol Nrip1
Ensembl Gene ENSMUSG00000048490
Gene Namenuclear receptor interacting protein 1
SynonymsRIP140, 6030458L20Rik, 8430438I05Rik
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0320 (G1)
Quality Score184
Status Validated
Chromosome16
Chromosomal Location76287400-76373827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76292363 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 769 (T769A)
Ref Sequence ENSEMBL: ENSMUSP00000112959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054178] [ENSMUST00000121927] [ENSMUST00000140483] [ENSMUST00000231585]
Predicted Effect probably benign
Transcript: ENSMUST00000054178
AA Change: T769A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051726
Gene: ENSMUSG00000048490
AA Change: T769A

DomainStartEndE-ValueType
low complexity region 182 195 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
PDB:2GPP|D 368 392 2e-7 PDB
low complexity region 707 718 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121927
AA Change: T769A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112959
Gene: ENSMUSG00000048490
AA Change: T769A

DomainStartEndE-ValueType
Pfam:NRIP1_repr_1 27 331 5.4e-141 PFAM
PDB:2GPP|D 368 392 2e-7 PDB
Pfam:NRIP1_repr_2 412 739 7.5e-122 PFAM
Pfam:NRIP1_repr_3 754 841 8.4e-45 PFAM
Pfam:NRIP1_repr_4 849 1161 1.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231304
Predicted Effect probably benign
Transcript: ENSMUST00000231585
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear receptor interacting protein 1 (NRIP1) is a nuclear protein that specifically interacts with the hormone-dependent activation domain AF2 of nuclear receptors. Also known as RIP140, this protein modulates transcriptional activity of the estrogen receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for targeted disruption of this gene results in female infertility due to ovulation failure. Heterozygous females are partially affected. Male and female mice are smaller than wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,614 T465A probably benign Het
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Aldh3b1 T C 19: 3,918,999 probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Cit C A 5: 115,979,445 L1227M possibly damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dopey2 C A 16: 93,810,147 R2113S probably benign Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Olfr689 A T 7: 105,314,654 I217F probably benign Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Parp4 T C 14: 56,588,496 probably null Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tigd4 T A 3: 84,595,174 V466E probably benign Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in Nrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nrip1 APN 16 76293703 missense possibly damaging 0.48
IGL00732:Nrip1 APN 16 76293061 missense probably benign 0.31
IGL02024:Nrip1 APN 16 76291675 missense probably benign 0.05
IGL02172:Nrip1 APN 16 76291492 missense probably damaging 0.99
IGL02432:Nrip1 APN 16 76291780 missense probably benign 0.04
IGL03025:Nrip1 APN 16 76294465 missense probably benign 0.06
IGL03410:Nrip1 APN 16 76292491 missense probably benign
PIT4802001:Nrip1 UTSW 16 76293269 missense probably damaging 0.97
R0064:Nrip1 UTSW 16 76294670 utr 5 prime probably benign
R0304:Nrip1 UTSW 16 76292707 missense possibly damaging 0.67
R0368:Nrip1 UTSW 16 76294016 missense probably damaging 0.99
R1730:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1783:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1850:Nrip1 UTSW 16 76293344 missense probably damaging 1.00
R1900:Nrip1 UTSW 16 76292039 missense probably benign
R2252:Nrip1 UTSW 16 76291285 missense probably damaging 1.00
R3935:Nrip1 UTSW 16 76294435 missense possibly damaging 0.67
R4290:Nrip1 UTSW 16 76291988 missense probably benign 0.00
R4426:Nrip1 UTSW 16 76291405 missense possibly damaging 0.87
R4598:Nrip1 UTSW 16 76293080 missense probably damaging 1.00
R4607:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R4608:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R5893:Nrip1 UTSW 16 76293953 missense probably damaging 1.00
R5939:Nrip1 UTSW 16 76292122 missense probably damaging 0.99
R5966:Nrip1 UTSW 16 76293583 missense possibly damaging 0.47
R6093:Nrip1 UTSW 16 76294764 start gained probably benign
R6154:Nrip1 UTSW 16 76293830 missense probably damaging 1.00
R6639:Nrip1 UTSW 16 76293995 nonsense probably null
R6910:Nrip1 UTSW 16 76294417 missense probably damaging 1.00
R6921:Nrip1 UTSW 16 76292588 missense possibly damaging 0.88
R7314:Nrip1 UTSW 16 76291190 missense probably benign 0.00
R7346:Nrip1 UTSW 16 76293356 missense possibly damaging 0.81
R7386:Nrip1 UTSW 16 76293887 missense probably damaging 1.00
R7485:Nrip1 UTSW 16 76291450 missense probably damaging 1.00
R7506:Nrip1 UTSW 16 76294459 missense probably damaging 1.00
R7517:Nrip1 UTSW 16 76291184 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTCAGCAAGCGACTCAACAG -3'
(R):5'- AGAGCAAAGCCTTCAGCAGTCAG -3'

Sequencing Primer
(F):5'- GCCCGTTCTTTGAGAAAGAGAAATC -3'
(R):5'- TGGAAAGACGGACTGTCCTTC -3'
Posted On2013-05-23