Mutagenetix > Incidental Mutation

Incidental Mutation 'R0320:Dopey2'

38314

Institutional Source

Beutler Lab

Gene Symbol

Dopey2

Ensembl Gene

ENSMUSG00000022946

Gene Name

dopey family member 2

Synonyms

0610038M01Rik, 2610510B01Rik

MMRRC Submission

038530-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0320 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93711904-93810590 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 93810147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 2113 (R2113S)

Ref Sequence

ENSEMBL: ENSMUSP00000154771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]

AlphaFold

Q3UHQ6

Predicted Effect

probably benign
Transcript: ENSMUST00000045004
AA Change: R2230S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: R2230S

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	308	3.9e-104	PFAM
low complexity region	651	666	N/A	INTRINSIC
low complexity region	709	719	N/A	INTRINSIC
low complexity region	747	759	N/A	INTRINSIC
low complexity region	1186	1199	N/A	INTRINSIC
low complexity region	1436	1451	N/A	INTRINSIC
low complexity region	1893	1908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226215

Predicted Effect

probably benign
Transcript: ENSMUST00000227156
AA Change: R2113S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227278

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228423

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231503

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231882

Meta Mutation Damage Score

0.0865

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

100% (71/71)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,662,614	T465A	probably benign	Het
9430007A20Rik	A	T	4: 144,522,420	H119L	probably damaging	Het
A430110L20Rik	T	G	1: 181,227,422		noncoding transcript	Het
Abcb10	C	T	8: 123,963,007	R439Q	probably benign	Het
Abcb8	T	C	5: 24,400,790	S199P	probably damaging	Het
Adam8	C	A	7: 139,986,442	C556F	probably damaging	Het
Akap11	T	C	14: 78,513,379	T523A	probably benign	Het
Aldh3b1	T	C	19: 3,918,999		probably benign	Het
Arhgap30	T	A	1: 171,403,804	W230R	possibly damaging	Het
Atp8b4	A	G	2: 126,459,694	I82T	possibly damaging	Het
Bptf	A	T	11: 107,072,819	L1850I	probably damaging	Het
C4b	C	A	17: 34,733,161	V1237L	probably benign	Het
Calu	C	A	6: 29,374,551		probably benign	Het
Ccdc129	T	C	6: 55,976,447	I916T	probably damaging	Het
Cit	C	A	5: 115,979,445	L1227M	possibly damaging	Het
Col4a1	C	T	8: 11,242,782		probably null	Het
Cp	T	C	3: 19,974,848		probably benign	Het
Cpd	T	C	11: 76,840,447	D311G	possibly damaging	Het
Ctc1	T	A	11: 69,033,537	S972T	probably damaging	Het
Dnah17	A	G	11: 118,052,674	F3201L	possibly damaging	Het
Dym	T	A	18: 75,199,262	D520E	probably damaging	Het
Eif5a	G	T	11: 69,917,479	T64K	probably benign	Het
Flt3	A	T	5: 147,369,579		probably benign	Het
Ints6	A	T	14: 62,707,635	Y415*	probably null	Het
Itga1	A	G	13: 114,977,594		probably benign	Het
Itgae	A	G	11: 73,130,999	H902R	possibly damaging	Het
Kdm5a	T	C	6: 120,389,620	I406T	probably benign	Het
Lmx1a	C	T	1: 167,791,404	Q111*	probably null	Het
Lrrc25	T	C	8: 70,618,246	Y226H	probably benign	Het
Mcam	T	A	9: 44,140,186	N447K	possibly damaging	Het
Mcm10	A	T	2: 5,004,086	D357E	probably benign	Het
Nrip1	T	C	16: 76,292,363	T769A	probably benign	Het
Ofcc1	G	C	13: 40,206,696	Q286E	probably benign	Het
Olfr382	T	G	11: 73,516,924	I92L	probably damaging	Het
Olfr689	A	T	7: 105,314,654	I217F	probably benign	Het
Parp3	T	A	9: 106,475,812	N55I	possibly damaging	Het
Parp4	T	C	14: 56,588,496		probably null	Het
Pilrb1	G	A	5: 137,854,998	T181I	probably benign	Het
Ppm1n	A	G	7: 19,278,356	V317A	probably damaging	Het
Prdm2	A	T	4: 143,179,351	F55L	probably damaging	Het
Psd2	C	T	18: 35,979,644	R131C	probably damaging	Het
Ralgps1	A	T	2: 33,141,015	C570S	possibly damaging	Het
Scaf8	T	C	17: 3,178,255	S443P	unknown	Het
Setd5	A	G	6: 113,111,481	K190R	probably damaging	Het
Spsb4	T	A	9: 96,996,108	H54L	probably damaging	Het
St7l	T	A	3: 104,870,913	L122*	probably null	Het
Stom	C	T	2: 35,321,634	R125H	probably damaging	Het
Tigd4	T	A	3: 84,595,174	V466E	probably benign	Het
Tmc3	A	C	7: 83,607,819		probably benign	Het
Vcl	C	T	14: 20,985,624		probably benign	Het
Vmn1r168	G	A	7: 23,541,342	R208H	probably benign	Het
Vmn2r75	C	A	7: 86,165,080	V402L	probably benign	Het
Vps13b	A	T	15: 35,674,828	H1698L	probably damaging	Het
Wnt16	T	G	6: 22,297,993	V286G	possibly damaging	Het
Xirp1	C	A	9: 120,016,467	V1117L	probably benign	Het
Zfp788	C	T	7: 41,649,547	H536Y	probably damaging	Het

Other mutations in Dopey2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Dopey2	APN	16	93800026	unclassified	probably benign
IGL00492:Dopey2	APN	16	93780782	missense	probably benign	0.00
IGL00753:Dopey2	APN	16	93769624	missense	probably benign
IGL00832:Dopey2	APN	16	93763401	missense	probably benign	0.01
IGL00939:Dopey2	APN	16	93774083	missense	possibly damaging	0.83
IGL01019:Dopey2	APN	16	93810229	missense	probably benign	0.32
IGL01288:Dopey2	APN	16	93739293	missense	possibly damaging	0.78
IGL01505:Dopey2	APN	16	93757116	missense	possibly damaging	0.87
IGL01535:Dopey2	APN	16	93769958	nonsense	probably null
IGL01696:Dopey2	APN	16	93770240	missense	probably benign	0.00
IGL02077:Dopey2	APN	16	93780760	missense	probably damaging	0.96
IGL02163:Dopey2	APN	16	93762427	missense	possibly damaging	0.48
IGL02234:Dopey2	APN	16	93752151	missense	probably benign
IGL02302:Dopey2	APN	16	93810117	missense	probably benign	0.08
IGL02485:Dopey2	APN	16	93770822	missense	probably damaging	1.00
IGL02563:Dopey2	APN	16	93777405	missense	probably damaging	0.99
IGL02733:Dopey2	APN	16	93739191	missense	possibly damaging	0.80
IGL02792:Dopey2	APN	16	93801572	missense	possibly damaging	0.75
IGL02941:Dopey2	APN	16	93755473	missense	probably benign	0.09
IGL03143:Dopey2	APN	16	93759655	missense	probably benign
PIT4519001:Dopey2	UTSW	16	93762054	missense	probably benign
R0499:Dopey2	UTSW	16	93770437	missense	probably benign	0.00
R0501:Dopey2	UTSW	16	93752862	missense	probably benign	0.00
R0534:Dopey2	UTSW	16	93762505	missense	probably benign	0.04
R0583:Dopey2	UTSW	16	93755486	missense	probably benign	0.30
R0626:Dopey2	UTSW	16	93763956	missense	probably damaging	1.00
R0724:Dopey2	UTSW	16	93762325	missense	probably benign	0.01
R0907:Dopey2	UTSW	16	93801593	missense	probably damaging	1.00
R1263:Dopey2	UTSW	16	93777386	missense	probably benign
R1378:Dopey2	UTSW	16	93770392	missense	probably benign
R1572:Dopey2	UTSW	16	93770153	missense	probably damaging	1.00
R1604:Dopey2	UTSW	16	93762570	missense	probably benign
R1642:Dopey2	UTSW	16	93762315	missense	probably benign	0.00
R1668:Dopey2	UTSW	16	93765516	missense	probably damaging	1.00
R1669:Dopey2	UTSW	16	93769660	missense	probably damaging	1.00
R1702:Dopey2	UTSW	16	93747621	missense	possibly damaging	0.47
R1711:Dopey2	UTSW	16	93799926	missense	probably damaging	1.00
R1917:Dopey2	UTSW	16	93716262	missense	probably damaging	1.00
R1968:Dopey2	UTSW	16	93782419	missense	probably damaging	1.00
R1988:Dopey2	UTSW	16	93766173	missense	probably damaging	1.00
R2029:Dopey2	UTSW	16	93769435	missense	probably benign	0.36
R2139:Dopey2	UTSW	16	93771007	missense	possibly damaging	0.78
R2355:Dopey2	UTSW	16	93770677	missense	probably damaging	1.00
R3609:Dopey2	UTSW	16	93739332	missense	probably damaging	1.00
R3792:Dopey2	UTSW	16	93771846	missense	possibly damaging	0.54
R4364:Dopey2	UTSW	16	93770924	missense	probably benign	0.00
R4380:Dopey2	UTSW	16	93716232	missense	possibly damaging	0.53
R4455:Dopey2	UTSW	16	93766215	missense	probably damaging	1.00
R4779:Dopey2	UTSW	16	93757081	missense	probably damaging	1.00
R4820:Dopey2	UTSW	16	93793090	missense	probably benign	0.00
R4834:Dopey2	UTSW	16	93740004	start codon destroyed	probably null	0.70
R4866:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R4882:Dopey2	UTSW	16	93752914	missense	possibly damaging	0.95
R4900:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R5153:Dopey2	UTSW	16	93774003	missense	probably damaging	0.98
R5176:Dopey2	UTSW	16	93740043	missense	probably damaging	1.00
R5206:Dopey2	UTSW	16	93801584	missense	probably damaging	1.00
R5320:Dopey2	UTSW	16	93739986	missense	probably damaging	1.00
R5361:Dopey2	UTSW	16	93770504	missense	probably damaging	1.00
R5380:Dopey2	UTSW	16	93763410	missense	probably damaging	0.96
R5476:Dopey2	UTSW	16	93773913	splice site	probably null
R5502:Dopey2	UTSW	16	93793226	missense	probably benign	0.00
R5543:Dopey2	UTSW	16	93798920	missense	probably damaging	0.98
R5557:Dopey2	UTSW	16	93763931	missense	probably damaging	0.96
R5901:Dopey2	UTSW	16	93769751	missense	possibly damaging	0.88
R5907:Dopey2	UTSW	16	93801581	missense	probably damaging	1.00
R6174:Dopey2	UTSW	16	93766222	missense	probably damaging	1.00
R6256:Dopey2	UTSW	16	93807214	missense	possibly damaging	0.94
R6383:Dopey2	UTSW	16	93782248	missense	possibly damaging	0.76
R6525:Dopey2	UTSW	16	93809416	missense	probably damaging	1.00
R6554:Dopey2	UTSW	16	93760458	missense	probably benign	0.22
R6823:Dopey2	UTSW	16	93755485	missense	possibly damaging	0.75
R7036:Dopey2	UTSW	16	93777490	missense	probably benign	0.01
R7058:Dopey2	UTSW	16	93776990	missense	probably benign	0.00
R7061:Dopey2	UTSW	16	93762063	missense	probably benign	0.00
R7209:Dopey2	UTSW	16	93769845	missense	probably benign
R7214:Dopey2	UTSW	16	93810135	missense	possibly damaging	0.69
R7232:Dopey2	UTSW	16	93760485	critical splice donor site	probably null
R7255:Dopey2	UTSW	16	93770146	missense	probably damaging	1.00
R7335:Dopey2	UTSW	16	93747508	missense	probably benign	0.04
R7535:Dopey2	UTSW	16	93806361	missense	probably damaging	1.00
R7700:Dopey2	UTSW	16	93798761	splice site	probably null
R7763:Dopey2	UTSW	16	93755514	missense	probably benign	0.00
R7814:Dopey2	UTSW	16	93799971	missense	probably damaging	1.00
R7839:Dopey2	UTSW	16	93763941	missense	probably damaging	1.00
R7862:Dopey2	UTSW	16	93749963	missense	probably damaging	1.00
R7894:Dopey2	UTSW	16	93810204	missense	probably benign	0.01
R7952:Dopey2	UTSW	16	93749960	missense	possibly damaging	0.93
R7956:Dopey2	UTSW	16	93771028	critical splice donor site	probably null
R8033:Dopey2	UTSW	16	93769483	missense	probably benign
R8061:Dopey2	UTSW	16	93749996	missense	probably damaging	1.00
R8067:Dopey2	UTSW	16	93765448	nonsense	probably null
R8146:Dopey2	UTSW	16	93749939	missense	possibly damaging	0.95
R8184:Dopey2	UTSW	16	93776993	missense	probably benign	0.13
R8221:Dopey2	UTSW	16	93749959	missense	probably benign	0.01
R8263:Dopey2	UTSW	16	93762195	missense	possibly damaging	0.87
R8329:Dopey2	UTSW	16	93771787	missense	probably damaging	1.00
R8555:Dopey2	UTSW	16	93771810	missense	probably damaging	1.00
R8683:Dopey2	UTSW	16	93771811	missense	probably damaging	0.98
R8683:Dopey2	UTSW	16	93773921	missense	probably benign
R8716:Dopey2	UTSW	16	93780785	nonsense	probably null
R8807:Dopey2	UTSW	16	93762085	missense	probably benign	0.03
R8840:Dopey2	UTSW	16	93810117	missense	probably benign	0.08
R8851:Dopey2	UTSW	16	93762510	missense	probably benign	0.39
R8884:Dopey2	UTSW	16	93759662	missense	probably benign
R8976:Dopey2	UTSW	16	93762081	missense	probably benign	0.01
R9219:Dopey2	UTSW	16	93770296	missense	probably damaging	1.00
R9238:Dopey2	UTSW	16	93749130	missense	probably benign	0.14
R9284:Dopey2	UTSW	16	93760308	missense	probably damaging	1.00
R9289:Dopey2	UTSW	16	93771793	missense	probably damaging	1.00
R9298:Dopey2	UTSW	16	93800199	missense	probably damaging	0.96
R9338:Dopey2	UTSW	16	93803560	missense	probably damaging	1.00
R9346:Dopey2	UTSW	16	93780814	critical splice donor site	probably null
R9444:Dopey2	UTSW	16	93810239	missense	probably benign	0.00
R9500:Dopey2	UTSW	16	93810283	missense	probably benign
R9601:Dopey2	UTSW	16	93747643	missense	possibly damaging	0.87
R9793:Dopey2	UTSW	16	93801615	missense	probably benign	0.30
Z1088:Dopey2	UTSW	16	93763326	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93769581	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93803546	missense	probably damaging	1.00
Z1176:Dopey2	UTSW	16	93807868	missense	possibly damaging	0.82
Z1177:Dopey2	UTSW	16	93763895	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGACCTGGAATGTGAGGTCTGC -3'
(R):5'- AACAGCACTTCAGGACTGTGGC -3'

Sequencing Primer
(F):5'- GAGGTCTGCCTCTGTCATCAG -3'
(R):5'- GATGCTCCAGAAAGTCCTGC -3'

Posted On

2013-05-23