Incidental Mutation 'R0320:Dopey2'
ID38314
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Namedopey family member 2
Synonyms0610038M01Rik, 2610510B01Rik
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0320 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location93711904-93810590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93810147 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 2113 (R2113S)
Ref Sequence ENSEMBL: ENSMUSP00000154771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]
Predicted Effect probably benign
Transcript: ENSMUST00000045004
AA Change: R2230S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: R2230S

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226215
Predicted Effect probably benign
Transcript: ENSMUST00000227156
AA Change: R2113S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231882
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,614 T465A probably benign Het
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Aldh3b1 T C 19: 3,918,999 probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Cit C A 5: 115,979,445 L1227M possibly damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Nrip1 T C 16: 76,292,363 T769A probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Olfr689 A T 7: 105,314,654 I217F probably benign Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Parp4 T C 14: 56,588,496 probably null Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tigd4 T A 3: 84,595,174 V466E probably benign Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1917:Dopey2 UTSW 16 93716262 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R1988:Dopey2 UTSW 16 93766173 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4882:Dopey2 UTSW 16 93752914 missense possibly damaging 0.95
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5361:Dopey2 UTSW 16 93770504 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5901:Dopey2 UTSW 16 93769751 missense possibly damaging 0.88
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7232:Dopey2 UTSW 16 93760485 critical splice donor site probably null
R7255:Dopey2 UTSW 16 93770146 missense probably damaging 1.00
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7700:Dopey2 UTSW 16 93798761 splice site probably null
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7952:Dopey2 UTSW 16 93749960 missense possibly damaging 0.93
R7956:Dopey2 UTSW 16 93771028 critical splice donor site probably null
R8033:Dopey2 UTSW 16 93769483 missense probably benign
R8061:Dopey2 UTSW 16 93749996 missense probably damaging 1.00
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
R8146:Dopey2 UTSW 16 93749939 missense possibly damaging 0.95
R8184:Dopey2 UTSW 16 93776993 missense probably benign 0.13
R8221:Dopey2 UTSW 16 93749959 missense probably benign 0.01
R8263:Dopey2 UTSW 16 93762195 missense possibly damaging 0.87
R8329:Dopey2 UTSW 16 93771787 missense probably damaging 1.00
R8555:Dopey2 UTSW 16 93771810 missense probably damaging 1.00
R8683:Dopey2 UTSW 16 93771811 missense probably damaging 0.98
R8683:Dopey2 UTSW 16 93773921 missense probably benign
R8716:Dopey2 UTSW 16 93780785 nonsense probably null
R8807:Dopey2 UTSW 16 93762085 missense not run
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93803546 missense probably damaging 1.00
Z1176:Dopey2 UTSW 16 93807868 missense possibly damaging 0.82
Z1177:Dopey2 UTSW 16 93763895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGACCTGGAATGTGAGGTCTGC -3'
(R):5'- AACAGCACTTCAGGACTGTGGC -3'

Sequencing Primer
(F):5'- GAGGTCTGCCTCTGTCATCAG -3'
(R):5'- GATGCTCCAGAAAGTCCTGC -3'
Posted On2013-05-23