Incidental Mutation 'R4941:Bcor'
ID 383157
Institutional Source Beutler Lab
Gene Symbol Bcor
Ensembl Gene ENSMUSG00000040363
Gene Name BCL6 interacting corepressor
Synonyms 8430401K06Rik, 2900008C10Rik, 5830466J11Rik, D930024N20Rik
MMRRC Submission 042539-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.889) question?
Stock # R4941 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 11902979-12026594 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11906725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1551 (R1551Q)
Ref Sequence ENSEMBL: ENSMUSP00000111175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043441] [ENSMUST00000065143] [ENSMUST00000115512] [ENSMUST00000115513] [ENSMUST00000124033]
AlphaFold Q8CGN4
Predicted Effect probably damaging
Transcript: ENSMUST00000043441
AA Change: R1499Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048024
Gene: ENSMUSG00000040363
AA Change: R1499Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1374 1387 N/A INTRINSIC
ANK 1414 1444 1.6e1 SMART
ANK 1448 1477 8.26e-2 SMART
ANK 1481 1510 3.06e-5 SMART
low complexity region 1572 1583 N/A INTRINSIC
PDB:4HPL|A 1584 1700 1e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000065143
AA Change: R1517Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068618
Gene: ENSMUSG00000040363
AA Change: R1517Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
ANK 1432 1462 1.6e1 SMART
ANK 1466 1495 8.26e-2 SMART
ANK 1499 1528 3.06e-5 SMART
low complexity region 1590 1601 N/A INTRINSIC
PDB:4HPL|A 1602 1718 2e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115512
AA Change: R1533Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111174
Gene: ENSMUSG00000040363
AA Change: R1533Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1408 1421 N/A INTRINSIC
ANK 1448 1478 1.6e1 SMART
ANK 1482 1511 8.26e-2 SMART
ANK 1515 1544 3.06e-5 SMART
low complexity region 1606 1617 N/A INTRINSIC
PDB:4HPL|A 1618 1734 2e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115513
AA Change: R1551Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111175
Gene: ENSMUSG00000040363
AA Change: R1551Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
Pfam:BCOR 1205 1417 1.6e-77 PFAM
low complexity region 1426 1439 N/A INTRINSIC
ANK 1466 1496 1.6e1 SMART
ANK 1500 1529 8.26e-2 SMART
ANK 1533 1562 3.06e-5 SMART
low complexity region 1624 1635 N/A INTRINSIC
Pfam:PUFD 1638 1751 5.6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124033
AA Change: R1499Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116258
Gene: ENSMUSG00000040363
AA Change: R1499Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1374 1387 N/A INTRINSIC
ANK 1414 1444 1.6e1 SMART
ANK 1448 1477 8.26e-2 SMART
ANK 1481 1510 3.06e-5 SMART
low complexity region 1572 1583 N/A INTRINSIC
PDB:4HPL|A 1584 1700 1e-67 PDB
Meta Mutation Damage Score 0.2695 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as an interacting corepressor of BCL6, a POZ/zinc finger transcription repressor that is required for germinal center formation and may influence apoptosis. This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome Y.[provided by RefSeq, Jun 2010]
PHENOTYPE: Male chimeras hemizygous for either of two different gene trapped alleles die by E9.5 exhibiting anomalies in somite formation and heart looping, forebrain fusion, and microcephaly. Hemizygosity for other gene trapped alleles can cause patterning and embryo turning defects or abnormal gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,112,529 (GRCm39) I85F probably damaging Het
Abcc6 T A 7: 45,661,947 (GRCm39) I435F probably benign Het
Adam3 T C 8: 25,167,332 (GRCm39) probably benign Het
Adrb3 T C 8: 27,717,450 (GRCm39) Y333C probably damaging Het
Ago4 A T 4: 126,419,847 (GRCm39) D43E probably benign Het
Agt T A 8: 125,283,727 (GRCm39) Q464L probably benign Het
Amdhd1 A T 10: 93,367,463 (GRCm39) D230E probably damaging Het
Aplf A G 6: 87,645,405 (GRCm39) I33T probably damaging Het
Aplf A T 6: 87,623,331 (GRCm39) N249K probably benign Het
Arap2 A G 5: 62,906,821 (GRCm39) M66T probably benign Het
Atf4 T C 15: 80,140,434 (GRCm39) probably benign Het
Bahcc1 A C 11: 120,177,491 (GRCm39) H2068P probably benign Het
Bltp1 A C 3: 36,971,851 (GRCm39) H528P probably damaging Het
Bltp1 G A 3: 36,974,050 (GRCm39) S600N probably benign Het
Catsper1 C A 19: 5,391,466 (GRCm39) A616D possibly damaging Het
Cdkn3 A G 14: 47,007,320 (GRCm39) D159G possibly damaging Het
Cep162 T C 9: 87,108,022 (GRCm39) probably benign Het
Clca3a1 T A 3: 144,721,414 (GRCm39) I386L probably damaging Het
Cldn10 G A 14: 119,025,725 (GRCm39) G53S possibly damaging Het
Cmtm3 T C 8: 105,070,460 (GRCm39) L73P probably damaging Het
Cnksr3 A C 10: 7,102,925 (GRCm39) L149R probably benign Het
Cope T C 8: 70,755,584 (GRCm39) probably null Het
Cpa6 T A 1: 10,479,562 (GRCm39) M224L probably benign Het
Cyp2d41-ps T C 15: 82,666,154 (GRCm39) noncoding transcript Het
Ddx55 T A 5: 124,706,779 (GRCm39) L592* probably null Het
Deup1 T C 9: 15,499,323 (GRCm39) M333V probably benign Het
Eif4a1 T C 11: 69,558,640 (GRCm39) probably benign Het
Eif4g3 A C 4: 137,897,876 (GRCm39) D1026A probably damaging Het
Eif5b T C 1: 38,090,280 (GRCm39) V1153A probably damaging Het
Ercc8 G T 13: 108,297,301 (GRCm39) probably benign Het
Fam227a C A 15: 79,524,204 (GRCm39) probably null Het
Fat1 A G 8: 45,489,312 (GRCm39) I3505V probably benign Het
Fat3 T G 9: 16,286,448 (GRCm39) E1025A probably damaging Het
Fat4 C T 3: 39,011,601 (GRCm39) R2234W probably damaging Het
Fer1l4 G T 2: 155,887,009 (GRCm39) F634L probably damaging Het
Fetub G A 16: 22,756,624 (GRCm39) V162I probably benign Het
Fgd4 T C 16: 16,302,402 (GRCm39) Q51R probably benign Het
Fgfr2 T C 7: 129,800,175 (GRCm39) H140R probably benign Het
Flt3 T A 5: 147,293,185 (GRCm39) probably null Het
Gabrb1 A G 5: 72,294,121 (GRCm39) N465S probably damaging Het
Gapdhs T C 7: 30,432,691 (GRCm39) I206V probably benign Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Glp2r T C 11: 67,637,529 (GRCm39) probably null Het
Gm4956 T A 1: 21,368,306 (GRCm39) noncoding transcript Het
Gtf2a1l A T 17: 89,022,350 (GRCm39) D447V probably damaging Het
Hsd3b5 A G 3: 98,526,379 (GRCm39) W356R probably damaging Het
Idh2 A T 7: 79,745,847 (GRCm39) V335D probably damaging Het
Isyna1 T C 8: 71,048,146 (GRCm39) I184T probably damaging Het
Kcnh2 A G 5: 24,536,085 (GRCm39) S320P probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kpna6 A G 4: 129,541,825 (GRCm39) F524S probably damaging Het
Lap3 A T 5: 45,663,539 (GRCm39) M338L probably benign Het
Lins1 T C 7: 66,359,198 (GRCm39) probably benign Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lrrc43 A G 5: 123,639,126 (GRCm39) D385G probably benign Het
Maf T C 8: 116,433,532 (GRCm39) D24G unknown Het
Nell1 T C 7: 49,712,386 (GRCm39) S69P probably benign Het
Nkapd1 G T 9: 50,518,809 (GRCm39) Q268K probably benign Het
Or13p4 C T 4: 118,547,089 (GRCm39) V187I possibly damaging Het
Or2h1 C T 17: 37,404,484 (GRCm39) G94E probably damaging Het
Or2j6 T A 7: 139,980,792 (GRCm39) M56L probably benign Het
Or51af1 T C 7: 103,141,458 (GRCm39) D209G probably damaging Het
Or5an10 A G 19: 12,276,260 (GRCm39) S79P possibly damaging Het
Or8g54 T C 9: 39,707,160 (GRCm39) M163T possibly damaging Het
Oxld1 T C 11: 120,347,862 (GRCm39) T112A probably benign Het
Parp14 T C 16: 35,666,403 (GRCm39) N1210S probably benign Het
Pcdhb10 C A 18: 37,545,887 (GRCm39) T321K probably benign Het
Pcdhb8 C T 18: 37,489,059 (GRCm39) L246F probably benign Het
Pcdhga1 T A 18: 37,795,659 (GRCm39) I221K probably benign Het
Pcdhga9 T A 18: 37,871,185 (GRCm39) V338E probably damaging Het
Pdcd11 T C 19: 47,108,325 (GRCm39) S1231P probably damaging Het
Pde6c A T 19: 38,140,013 (GRCm39) L325F probably damaging Het
Pnpla7 T A 2: 24,887,276 (GRCm39) probably null Het
Pparg T A 6: 115,467,071 (GRCm39) V478E probably damaging Het
Ppib T C 9: 65,967,672 (GRCm39) V42A probably benign Het
Ppox T C 1: 171,105,166 (GRCm39) M341V probably damaging Het
Proc T C 18: 32,258,166 (GRCm39) K260E possibly damaging Het
Ptpro C T 6: 137,369,763 (GRCm39) P525L probably damaging Het
Rnf14 C A 18: 38,441,435 (GRCm39) A275E probably damaging Het
Scnn1b C T 7: 121,511,231 (GRCm39) P306L probably damaging Het
Sec14l5 A G 16: 4,994,364 (GRCm39) E386G probably damaging Het
Sftpa1 T A 14: 40,854,509 (GRCm39) I32N probably damaging Het
Slc26a5 A G 5: 22,025,384 (GRCm39) I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 (GRCm39) Y438C probably damaging Het
Spire1 T C 18: 67,652,384 (GRCm39) E231G possibly damaging Het
Stab1 T A 14: 30,873,528 (GRCm39) I1014F probably benign Het
Steap2 T C 5: 5,727,651 (GRCm39) Y228C probably damaging Het
Tmem131l T C 3: 83,806,546 (GRCm39) T1487A probably benign Het
Tmem171 A G 13: 98,828,803 (GRCm39) F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 (GRCm39) V199A probably damaging Het
Tmem45a T C 16: 56,642,652 (GRCm39) N173S possibly damaging Het
Uqcrc2 C T 7: 120,242,301 (GRCm39) R148C probably benign Het
Vmn2r116 A G 17: 23,620,116 (GRCm39) K617E probably damaging Het
Xrcc6 T C 15: 81,924,013 (GRCm39) L229P probably damaging Het
Yju2 A G 17: 56,271,149 (GRCm39) D97G possibly damaging Het
Zfp184 A G 13: 22,133,891 (GRCm39) D46G probably damaging Het
Zfp790 T A 7: 29,528,916 (GRCm39) C534S possibly damaging Het
Zfp990 A T 4: 145,263,407 (GRCm39) N135I probably damaging Het
Other mutations in Bcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Bcor APN X 11,904,059 (GRCm39) missense probably damaging 0.99
IGL02034:Bcor APN X 11,905,498 (GRCm39) missense possibly damaging 0.46
IGL02458:Bcor APN X 11,914,749 (GRCm39) missense probably damaging 1.00
IGL03330:Bcor APN X 11,925,110 (GRCm39) missense possibly damaging 0.65
R0648:Bcor UTSW X 11,925,290 (GRCm39) missense probably damaging 1.00
R2147:Bcor UTSW X 11,923,862 (GRCm39) missense possibly damaging 0.73
R2148:Bcor UTSW X 11,923,862 (GRCm39) missense possibly damaging 0.73
R5004:Bcor UTSW X 11,906,725 (GRCm39) missense probably damaging 1.00
R5162:Bcor UTSW X 11,906,725 (GRCm39) missense probably damaging 1.00
R5163:Bcor UTSW X 11,906,725 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCGAAACCATACTGTGC -3'
(R):5'- AGATGTGTACTTGAGAGCTGAC -3'

Sequencing Primer
(F):5'- GCACAGGTGAGTCAAACTTTTG -3'
(R):5'- CCCTTCACTGGTACTTTAGAAGAGAG -3'
Posted On 2016-04-27