Incidental Mutation 'R4942:Ercc5'
ID 383158
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4942 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 44147744-44181260 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44175965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 886 (D886G)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027214
AA Change: D886G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: D886G

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,903,258 R420G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
Adamts7 T C 9: 90,163,311 S23P probably benign Het
Adamtsl1 T A 4: 86,341,214 C824* probably null Het
Adgre1 A G 17: 57,406,903 Y196C probably damaging Het
Arap1 A G 7: 101,401,802 D542G possibly damaging Het
B3gat1 A G 9: 26,755,598 D42G probably benign Het
Birc6 G A 17: 74,623,050 A2412T probably damaging Het
Bsn A G 9: 108,106,479 Y3459H unknown Het
Cacnb1 T C 11: 98,002,983 Y571C probably damaging Het
Cdk2ap2 G A 19: 4,097,508 probably null Het
Cep57 A G 9: 13,813,427 S265P probably damaging Het
Clca1 A G 3: 145,004,763 I893T probably benign Het
Clca3a2 T A 3: 144,806,502 E491V probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cobl A T 11: 12,254,185 I832N probably damaging Het
Col9a2 T C 4: 121,053,119 V487A possibly damaging Het
Cse1l C T 2: 166,929,794 T325I probably damaging Het
Dlx6 A G 6: 6,863,468 Q30R probably benign Het
Dnah8 T C 17: 30,729,142 V1902A probably benign Het
Dusp8 A G 7: 142,082,228 F542L possibly damaging Het
Emid1 T G 11: 5,129,430 M323L probably benign Het
Fam184b T C 5: 45,573,307 E461G probably damaging Het
Fbn1 C A 2: 125,383,616 C572F possibly damaging Het
Gigyf1 G T 5: 137,525,690 V1041L possibly damaging Het
Grin3b A G 10: 79,975,722 H714R probably damaging Het
Heatr1 A G 13: 12,413,510 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lypd6b C A 2: 49,946,120 H104Q probably benign Het
Man1a A T 10: 53,933,490 probably null Het
Megf6 A T 4: 154,253,820 D449V probably damaging Het
Mtor T C 4: 148,472,142 V1003A probably benign Het
Ncan C A 8: 70,100,294 W1096L probably damaging Het
Ndor1 C T 2: 25,248,121 probably null Het
Ndufaf1 T C 2: 119,660,066 E171G possibly damaging Het
Nell1 T C 7: 50,120,649 V152A possibly damaging Het
Nt5dc1 A T 10: 34,322,677 V255E probably damaging Het
Olfr10 A T 11: 49,317,548 M1L probably null Het
Olfr434 T A 6: 43,216,994 F27Y probably damaging Het
Olfr619 G A 7: 103,604,194 R180H probably benign Het
Olfr652 A G 7: 104,565,005 I261M probably benign Het
Otud7a T C 7: 63,757,423 I50T probably damaging Het
P2ry13 G A 3: 59,209,562 T265I probably benign Het
Pde4d A G 13: 108,860,199 S12G probably benign Het
Pdzd3 C A 9: 44,248,618 G402* probably null Het
Pigk C A 3: 152,744,517 N219K probably damaging Het
Plcg1 T A 2: 160,753,589 probably null Het
Psd2 A T 18: 35,978,664 D114V probably damaging Het
Ptch1 A T 13: 63,525,070 I770N probably benign Het
Ptprq A T 10: 107,688,429 M481K probably benign Het
Rnf216 A C 5: 143,093,059 M45R probably damaging Het
Rpsa T A 9: 120,131,063 W231R probably benign Het
Ryr1 G T 7: 29,069,573 T2797N probably damaging Het
Ryr3 A T 2: 112,836,257 M1468K probably damaging Het
Slc6a7 A G 18: 61,004,517 Y244H probably damaging Het
Slco6c1 T A 1: 97,081,324 D462V probably damaging Het
Spata31d1b A T 13: 59,717,103 E688D possibly damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Tnrc18 A T 5: 142,787,982 I181N unknown Het
Tnrc6a T C 7: 123,192,613 F1785L probably damaging Het
Trio A T 15: 27,752,725 D2174E probably benign Het
Ttn C T 2: 76,793,256 V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 probably benign Het
Vmn2r113 C T 17: 22,958,347 P702S probably damaging Het
Vmn2r66 A T 7: 85,007,772 W142R probably damaging Het
Vmn2r73 A G 7: 85,870,374 Y459H probably damaging Het
Wsb2 C T 5: 117,377,485 T385M probably damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44167681 nonsense probably null
R8795:Ercc5 UTSW 1 44163929 missense possibly damaging 0.92
R9144:Ercc5 UTSW 1 44174351 missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44178343 missense possibly damaging 0.51
R9295:Ercc5 UTSW 1 44158857 missense probably damaging 1.00
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATATGTCCTCGGATGTTGGTTTAAC -3'
(R):5'- CAATGACTTGGGACAGCTTGTG -3'

Sequencing Primer
(F):5'- TGAGTTCCAGTACAGTCAGGGC -3'
(R):5'- GGGACAGCTTGTGATTTTAGAAAC -3'
Posted On 2016-04-27