Mutagenetix > Incidental Mutation

Incidental Mutation 'R4942:Ercc5'

383158

Institutional Source

Beutler Lab

Gene Symbol

Ercc5

Ensembl Gene

ENSMUSG00000026048

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 5

Synonyms

Xpg

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44147744-44181260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44175965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 886 (D886G)

Ref Sequence

ENSEMBL: ENSMUSP00000027214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027214]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027214
AA Change: D886G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: D886G

Domain	Start	End	E-Value	Type
XPGN	1	98	3.49e-50	SMART
low complexity region	104	115	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
low complexity region	641	650	N/A	INTRINSIC
XPGI	776	845	1.02e-33	SMART
HhH2	847	880	2.94e-11	SMART
low complexity region	1130	1140	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131177

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	C	17: 28,903,258	R420G	probably benign	Het
5730522E02Rik	A	G	11: 25,770,472		probably null	Het
Adamts7	T	C	9: 90,163,311	S23P	probably benign	Het
Adamtsl1	T	A	4: 86,341,214	C824*	probably null	Het
Adgre1	A	G	17: 57,406,903	Y196C	probably damaging	Het
Arap1	A	G	7: 101,401,802	D542G	possibly damaging	Het
B3gat1	A	G	9: 26,755,598	D42G	probably benign	Het
Birc6	G	A	17: 74,623,050	A2412T	probably damaging	Het
Bsn	A	G	9: 108,106,479	Y3459H	unknown	Het
Cacnb1	T	C	11: 98,002,983	Y571C	probably damaging	Het
Cdk2ap2	G	A	19: 4,097,508		probably null	Het
Cep57	A	G	9: 13,813,427	S265P	probably damaging	Het
Clca1	A	G	3: 145,004,763	I893T	probably benign	Het
Clca3a2	T	A	3: 144,806,502	E491V	probably damaging	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Cobl	A	T	11: 12,254,185	I832N	probably damaging	Het
Col9a2	T	C	4: 121,053,119	V487A	possibly damaging	Het
Cse1l	C	T	2: 166,929,794	T325I	probably damaging	Het
Dlx6	A	G	6: 6,863,468	Q30R	probably benign	Het
Dnah8	T	C	17: 30,729,142	V1902A	probably benign	Het
Dusp8	A	G	7: 142,082,228	F542L	possibly damaging	Het
Emid1	T	G	11: 5,129,430	M323L	probably benign	Het
Fam184b	T	C	5: 45,573,307	E461G	probably damaging	Het
Fbn1	C	A	2: 125,383,616	C572F	possibly damaging	Het
Gigyf1	G	T	5: 137,525,690	V1041L	possibly damaging	Het
Grin3b	A	G	10: 79,975,722	H714R	probably damaging	Het
Heatr1	A	G	13: 12,413,510		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Lypd6b	C	A	2: 49,946,120	H104Q	probably benign	Het
Man1a	A	T	10: 53,933,490		probably null	Het
Megf6	A	T	4: 154,253,820	D449V	probably damaging	Het
Mtor	T	C	4: 148,472,142	V1003A	probably benign	Het
Ncan	C	A	8: 70,100,294	W1096L	probably damaging	Het
Ndor1	C	T	2: 25,248,121		probably null	Het
Ndufaf1	T	C	2: 119,660,066	E171G	possibly damaging	Het
Nell1	T	C	7: 50,120,649	V152A	possibly damaging	Het
Nt5dc1	A	T	10: 34,322,677	V255E	probably damaging	Het
Olfr10	A	T	11: 49,317,548	M1L	probably null	Het
Olfr434	T	A	6: 43,216,994	F27Y	probably damaging	Het
Olfr619	G	A	7: 103,604,194	R180H	probably benign	Het
Olfr652	A	G	7: 104,565,005	I261M	probably benign	Het
Otud7a	T	C	7: 63,757,423	I50T	probably damaging	Het
P2ry13	G	A	3: 59,209,562	T265I	probably benign	Het
Pde4d	A	G	13: 108,860,199	S12G	probably benign	Het
Pdzd3	C	A	9: 44,248,618	G402*	probably null	Het
Pigk	C	A	3: 152,744,517	N219K	probably damaging	Het
Plcg1	T	A	2: 160,753,589		probably null	Het
Psd2	A	T	18: 35,978,664	D114V	probably damaging	Het
Ptch1	A	T	13: 63,525,070	I770N	probably benign	Het
Ptprq	A	T	10: 107,688,429	M481K	probably benign	Het
Rnf216	A	C	5: 143,093,059	M45R	probably damaging	Het
Rpsa	T	A	9: 120,131,063	W231R	probably benign	Het
Ryr1	G	T	7: 29,069,573	T2797N	probably damaging	Het
Ryr3	A	T	2: 112,836,257	M1468K	probably damaging	Het
Slc6a7	A	G	18: 61,004,517	Y244H	probably damaging	Het
Slco6c1	T	A	1: 97,081,324	D462V	probably damaging	Het
Spata31d1b	A	T	13: 59,717,103	E688D	possibly damaging	Het
Srpr	G	A	9: 35,215,470	R508H	probably benign	Het
Tnrc18	A	T	5: 142,787,982	I181N	unknown	Het
Tnrc6a	T	C	7: 123,192,613	F1785L	probably damaging	Het
Trio	A	T	15: 27,752,725	D2174E	probably benign	Het
Ttn	C	T	2: 76,793,256	V15326I	probably damaging	Het
Ubap2	T	A	4: 41,245,461		probably benign	Het
Vmn2r113	C	T	17: 22,958,347	P702S	probably damaging	Het
Vmn2r66	A	T	7: 85,007,772	W142R	probably damaging	Het
Vmn2r73	A	G	7: 85,870,374	Y459H	probably damaging	Het
Wsb2	C	T	5: 117,377,485	T385M	probably damaging	Het

Other mutations in Ercc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Ercc5	APN	1	44163898	missense	probably damaging	1.00
IGL00782:Ercc5	APN	1	44163935	missense	probably damaging	1.00
IGL01418:Ercc5	APN	1	44167280	missense	probably benign	0.43
IGL01710:Ercc5	APN	1	44164075	missense	probably damaging	1.00
IGL02528:Ercc5	APN	1	44167802	missense	probably benign	0.00
IGL02589:Ercc5	APN	1	44164049	missense	probably damaging	1.00
IGL02651:Ercc5	APN	1	44156944	missense	probably damaging	1.00
IGL02740:Ercc5	APN	1	44167492	missense	probably benign	0.00
IGL02999:Ercc5	APN	1	44167654	missense	probably benign	0.00
IGL03057:Ercc5	APN	1	44167001	missense	probably damaging	0.99
IGL03246:Ercc5	APN	1	44167081	missense	probably damaging	1.00
R0084:Ercc5	UTSW	1	44175976	missense	possibly damaging	0.53
R0448:Ercc5	UTSW	1	44173940	missense	probably damaging	1.00
R1120:Ercc5	UTSW	1	44161841	missense	probably damaging	1.00
R1312:Ercc5	UTSW	1	44164019	missense	probably damaging	1.00
R1411:Ercc5	UTSW	1	44178281	missense	probably damaging	0.99
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1528:Ercc5	UTSW	1	44178241	nonsense	probably null
R1637:Ercc5	UTSW	1	44167534	missense	probably benign	0.00
R1668:Ercc5	UTSW	1	44167033	missense	probably benign	0.04
R1714:Ercc5	UTSW	1	44167339	missense	probably benign	0.01
R1780:Ercc5	UTSW	1	44167796	missense	probably benign	0.17
R1800:Ercc5	UTSW	1	44173380	missense	probably benign	0.00
R1835:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1836:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1886:Ercc5	UTSW	1	44175976	nonsense	probably null
R2344:Ercc5	UTSW	1	44167169	missense	probably benign
R2680:Ercc5	UTSW	1	44156973	missense	probably benign	0.09
R3033:Ercc5	UTSW	1	44180574	missense	possibly damaging	0.83
R3919:Ercc5	UTSW	1	44161931	missense	probably damaging	1.00
R3933:Ercc5	UTSW	1	44167856	missense	probably benign	0.17
R4444:Ercc5	UTSW	1	44158209	frame shift	probably null
R4578:Ercc5	UTSW	1	44148148	missense	probably benign	0.32
R4585:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4586:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4911:Ercc5	UTSW	1	44166871	missense	possibly damaging	0.66
R4912:Ercc5	UTSW	1	44157057	missense	probably damaging	1.00
R5155:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
R5975:Ercc5	UTSW	1	44173406	missense	probably benign	0.04
R5991:Ercc5	UTSW	1	44180830	nonsense	probably null
R6161:Ercc5	UTSW	1	44167352	missense	probably benign	0.00
R6250:Ercc5	UTSW	1	44164049	missense	probably damaging	1.00
R7142:Ercc5	UTSW	1	44174214	missense	probably damaging	1.00
R7183:Ercc5	UTSW	1	44161808	critical splice acceptor site	probably null
R7183:Ercc5	UTSW	1	44161809	critical splice acceptor site	probably null
R7235:Ercc5	UTSW	1	44178203	missense	possibly damaging	0.68
R7349:Ercc5	UTSW	1	44180908	missense	possibly damaging	0.56
R7369:Ercc5	UTSW	1	44180860	missense	probably benign	0.39
R7486:Ercc5	UTSW	1	44148064	start codon destroyed	probably null	1.00
R7586:Ercc5	UTSW	1	44175851	missense	possibly damaging	0.49
R7904:Ercc5	UTSW	1	44175838	critical splice acceptor site	probably null
R7994:Ercc5	UTSW	1	44178334	missense	possibly damaging	0.94
R8432:Ercc5	UTSW	1	44167681	nonsense	probably null
R8795:Ercc5	UTSW	1	44163929	missense	possibly damaging	0.92
R9144:Ercc5	UTSW	1	44174351	missense	probably damaging	1.00
R9208:Ercc5	UTSW	1	44178343	missense	possibly damaging	0.51
R9295:Ercc5	UTSW	1	44158857	missense	probably damaging	1.00
R9516:Ercc5	UTSW	1	44167881	missense	probably damaging	1.00
X0011:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
X0062:Ercc5	UTSW	1	44173974	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATATGTCCTCGGATGTTGGTTTAAC -3'
(R):5'- CAATGACTTGGGACAGCTTGTG -3'

Sequencing Primer
(F):5'- TGAGTTCCAGTACAGTCAGGGC -3'
(R):5'- GGGACAGCTTGTGATTTTAGAAAC -3'

Posted On

2016-04-27