Incidental Mutation 'R4942:Slco6c1'
ID383159
Institutional Source Beutler Lab
Gene Symbol Slco6c1
Ensembl Gene ENSMUSG00000026331
Gene Namesolute carrier organic anion transporter family, member 6c1
Synonyms4933404A18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4942 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location97059038-97128301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97081324 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 462 (D462V)
Ref Sequence ENSEMBL: ENSMUSP00000140791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027569] [ENSMUST00000189547]
Predicted Effect probably damaging
Transcript: ENSMUST00000027569
AA Change: D479V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027569
Gene: ENSMUSG00000026331
AA Change: D479V

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 95 654 3e-101 PFAM
Pfam:MFS_1 207 474 6.5e-14 PFAM
Pfam:Kazal_2 497 538 7.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189547
AA Change: D462V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140791
Gene: ENSMUSG00000026331
AA Change: D462V

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 93 197 7.4e-12 PFAM
Pfam:MFS_1 99 457 2.2e-15 PFAM
Pfam:OATP 192 638 2.5e-64 PFAM
Pfam:Kazal_2 480 521 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,903,258 R420G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
Adamts7 T C 9: 90,163,311 S23P probably benign Het
Adamtsl1 T A 4: 86,341,214 C824* probably null Het
Adgre1 A G 17: 57,406,903 Y196C probably damaging Het
Arap1 A G 7: 101,401,802 D542G possibly damaging Het
B3gat1 A G 9: 26,755,598 D42G probably benign Het
Birc6 G A 17: 74,623,050 A2412T probably damaging Het
Bsn A G 9: 108,106,479 Y3459H unknown Het
Cacnb1 T C 11: 98,002,983 Y571C probably damaging Het
Cdk2ap2 G A 19: 4,097,508 probably null Het
Cep57 A G 9: 13,813,427 S265P probably damaging Het
Clca1 A G 3: 145,004,763 I893T probably benign Het
Clca3a2 T A 3: 144,806,502 E491V probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cobl A T 11: 12,254,185 I832N probably damaging Het
Col9a2 T C 4: 121,053,119 V487A possibly damaging Het
Cse1l C T 2: 166,929,794 T325I probably damaging Het
Dlx6 A G 6: 6,863,468 Q30R probably benign Het
Dnah8 T C 17: 30,729,142 V1902A probably benign Het
Dusp8 A G 7: 142,082,228 F542L possibly damaging Het
Emid1 T G 11: 5,129,430 M323L probably benign Het
Ercc5 A G 1: 44,175,965 D886G probably benign Het
Fam184b T C 5: 45,573,307 E461G probably damaging Het
Fbn1 C A 2: 125,383,616 C572F possibly damaging Het
Gigyf1 G T 5: 137,525,690 V1041L possibly damaging Het
Grin3b A G 10: 79,975,722 H714R probably damaging Het
Heatr1 A G 13: 12,413,510 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lypd6b C A 2: 49,946,120 H104Q probably benign Het
Man1a A T 10: 53,933,490 probably null Het
Megf6 A T 4: 154,253,820 D449V probably damaging Het
Mtor T C 4: 148,472,142 V1003A probably benign Het
Ncan C A 8: 70,100,294 W1096L probably damaging Het
Ndor1 C T 2: 25,248,121 probably null Het
Ndufaf1 T C 2: 119,660,066 E171G possibly damaging Het
Nell1 T C 7: 50,120,649 V152A possibly damaging Het
Nt5dc1 A T 10: 34,322,677 V255E probably damaging Het
Olfr10 A T 11: 49,317,548 M1L probably null Het
Olfr434 T A 6: 43,216,994 F27Y probably damaging Het
Olfr619 G A 7: 103,604,194 R180H probably benign Het
Olfr652 A G 7: 104,565,005 I261M probably benign Het
Otud7a T C 7: 63,757,423 I50T probably damaging Het
P2ry13 G A 3: 59,209,562 T265I probably benign Het
Pde4d A G 13: 108,860,199 S12G probably benign Het
Pdzd3 C A 9: 44,248,618 G402* probably null Het
Pigk C A 3: 152,744,517 N219K probably damaging Het
Plcg1 T A 2: 160,753,589 probably null Het
Psd2 A T 18: 35,978,664 D114V probably damaging Het
Ptch1 A T 13: 63,525,070 I770N probably benign Het
Ptprq A T 10: 107,688,429 M481K probably benign Het
Rnf216 A C 5: 143,093,059 M45R probably damaging Het
Rpsa T A 9: 120,131,063 W231R probably benign Het
Ryr1 G T 7: 29,069,573 T2797N probably damaging Het
Ryr3 A T 2: 112,836,257 M1468K probably damaging Het
Slc6a7 A G 18: 61,004,517 Y244H probably damaging Het
Spata31d1b A T 13: 59,717,103 E688D possibly damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Tnrc18 A T 5: 142,787,982 I181N unknown Het
Tnrc6a T C 7: 123,192,613 F1785L probably damaging Het
Trio A T 15: 27,752,725 D2174E probably benign Het
Ttn C T 2: 76,793,256 V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 probably benign Het
Vmn2r113 C T 17: 22,958,347 P702S probably damaging Het
Vmn2r66 A T 7: 85,007,772 W142R probably damaging Het
Vmn2r73 A G 7: 85,870,374 Y459H probably damaging Het
Wsb2 C T 5: 117,377,485 T385M probably damaging Het
Other mutations in Slco6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Slco6c1 APN 1 97087949 missense probably benign 0.00
IGL00571:Slco6c1 APN 1 97087951 missense probably benign 0.04
IGL01483:Slco6c1 APN 1 97128107 missense probably benign
IGL01543:Slco6c1 APN 1 97125828 missense possibly damaging 0.95
IGL01860:Slco6c1 APN 1 97075823 splice site probably benign
IGL03106:Slco6c1 APN 1 97066023 splice site probably benign
R0087:Slco6c1 UTSW 1 97118578 missense probably benign 0.00
R0543:Slco6c1 UTSW 1 97127898 missense probably damaging 0.99
R0674:Slco6c1 UTSW 1 97104773 splice site probably benign
R0826:Slco6c1 UTSW 1 97128101 missense probably benign 0.00
R0928:Slco6c1 UTSW 1 97104848 missense possibly damaging 0.88
R0969:Slco6c1 UTSW 1 97119960 missense probably benign 0.05
R1366:Slco6c1 UTSW 1 97128203 start gained probably null
R1559:Slco6c1 UTSW 1 97098498 missense probably damaging 1.00
R1594:Slco6c1 UTSW 1 97062438 missense probably benign 0.36
R1901:Slco6c1 UTSW 1 97072982 missense probably damaging 0.98
R2005:Slco6c1 UTSW 1 97081489 missense probably damaging 0.99
R2101:Slco6c1 UTSW 1 97072870 nonsense probably null
R2102:Slco6c1 UTSW 1 97127931 missense probably benign 0.02
R2120:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R2135:Slco6c1 UTSW 1 97104817 missense probably benign 0.01
R2295:Slco6c1 UTSW 1 97125748 missense probably damaging 1.00
R2437:Slco6c1 UTSW 1 97062476 missense probably benign 0.22
R4004:Slco6c1 UTSW 1 97075885 missense probably damaging 1.00
R4133:Slco6c1 UTSW 1 97081493 missense probably benign 0.02
R4643:Slco6c1 UTSW 1 97062424 missense probably benign 0.00
R4786:Slco6c1 UTSW 1 97087995 missense probably benign 0.04
R5485:Slco6c1 UTSW 1 97125756 missense probably damaging 1.00
R5573:Slco6c1 UTSW 1 97127931 missense probably benign 0.00
R5810:Slco6c1 UTSW 1 97075873 missense probably damaging 1.00
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6191:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R6197:Slco6c1 UTSW 1 97072793 critical splice donor site probably null
R6286:Slco6c1 UTSW 1 97125720 missense possibly damaging 0.90
R6404:Slco6c1 UTSW 1 97118605 missense probably damaging 1.00
R6430:Slco6c1 UTSW 1 97075974 missense probably benign 0.43
R6492:Slco6c1 UTSW 1 97125813 missense probably damaging 0.99
R6649:Slco6c1 UTSW 1 97125711 missense probably benign 0.44
R6940:Slco6c1 UTSW 1 97072901 missense possibly damaging 0.80
R7138:Slco6c1 UTSW 1 97119981 missense possibly damaging 0.95
R7213:Slco6c1 UTSW 1 97127946 missense probably benign
R7234:Slco6c1 UTSW 1 97125741 missense probably benign 0.06
R7320:Slco6c1 UTSW 1 97128162 missense possibly damaging 0.83
R7375:Slco6c1 UTSW 1 97081421 missense possibly damaging 0.58
R7383:Slco6c1 UTSW 1 97075883 nonsense probably null
R7422:Slco6c1 UTSW 1 97081482 missense probably benign 0.17
R7491:Slco6c1 UTSW 1 97127854 missense probably benign 0.32
R7561:Slco6c1 UTSW 1 97072966 missense probably damaging 1.00
R7890:Slco6c1 UTSW 1 97062467 missense possibly damaging 0.59
R7973:Slco6c1 UTSW 1 97062467 missense possibly damaging 0.59
R8115:Slco6c1 UTSW 1 97072961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGACCTGATCTCTCTACCTTG -3'
(R):5'- ACTTCCTGGAGGCATAATTGG -3'

Sequencing Primer
(F):5'- TGATCACAAATGACTCATGAATGC -3'
(R):5'- GGCATAATTGGCCATTTTCTTGG -3'
Posted On2016-04-27