Incidental Mutation 'R4942:Cse1l'
ID 383166
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4942 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 166771714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 325 (T325I)
Ref Sequence ENSEMBL: ENSMUSP00000129983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably damaging
Transcript: ENSMUST00000002790
AA Change: T381I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: T381I

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145819
Predicted Effect probably damaging
Transcript: ENSMUST00000163437
AA Change: T96I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: T96I

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166871
Predicted Effect probably damaging
Transcript: ENSMUST00000168599
AA Change: T325I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: T325I

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,720,472 (GRCm39) probably null Het
Adamts7 T C 9: 90,045,364 (GRCm39) S23P probably benign Het
Adamtsl1 T A 4: 86,259,451 (GRCm39) C824* probably null Het
Adgre1 A G 17: 57,713,903 (GRCm39) Y196C probably damaging Het
Arap1 A G 7: 101,051,009 (GRCm39) D542G possibly damaging Het
B3gat1 A G 9: 26,666,894 (GRCm39) D42G probably benign Het
Birc6 G A 17: 74,930,045 (GRCm39) A2412T probably damaging Het
Bnip5 T C 17: 29,122,232 (GRCm39) R420G probably benign Het
Bsn A G 9: 107,983,678 (GRCm39) Y3459H unknown Het
Cacnb1 T C 11: 97,893,809 (GRCm39) Y571C probably damaging Het
Cdk2ap2 G A 19: 4,147,508 (GRCm39) probably null Het
Cep57 A G 9: 13,724,723 (GRCm39) S265P probably damaging Het
Clca3a1 A G 3: 144,710,524 (GRCm39) I893T probably benign Het
Clca3a2 T A 3: 144,512,263 (GRCm39) E491V probably damaging Het
Cldn10 G A 14: 119,025,725 (GRCm39) G53S possibly damaging Het
Cobl A T 11: 12,204,185 (GRCm39) I832N probably damaging Het
Col9a2 T C 4: 120,910,316 (GRCm39) V487A possibly damaging Het
Dlx6 A G 6: 6,863,468 (GRCm39) Q30R probably benign Het
Dnah8 T C 17: 30,948,116 (GRCm39) V1902A probably benign Het
Dusp8 A G 7: 141,635,965 (GRCm39) F542L possibly damaging Het
Emid1 T G 11: 5,079,430 (GRCm39) M323L probably benign Het
Ercc5 A G 1: 44,215,125 (GRCm39) D886G probably benign Het
Fam184b T C 5: 45,730,649 (GRCm39) E461G probably damaging Het
Fbn1 C A 2: 125,225,536 (GRCm39) C572F possibly damaging Het
Gigyf1 G T 5: 137,523,952 (GRCm39) V1041L possibly damaging Het
Grin3b A G 10: 79,811,556 (GRCm39) H714R probably damaging Het
Heatr1 A G 13: 12,428,391 (GRCm39) probably null Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lypd6b C A 2: 49,836,132 (GRCm39) H104Q probably benign Het
Man1a A T 10: 53,809,586 (GRCm39) probably null Het
Megf6 A T 4: 154,338,277 (GRCm39) D449V probably damaging Het
Mtor T C 4: 148,556,599 (GRCm39) V1003A probably benign Het
Ncan C A 8: 70,552,944 (GRCm39) W1096L probably damaging Het
Ndor1 C T 2: 25,138,133 (GRCm39) probably null Het
Ndufaf1 T C 2: 119,490,547 (GRCm39) E171G possibly damaging Het
Nell1 T C 7: 49,770,397 (GRCm39) V152A possibly damaging Het
Nherf4 C A 9: 44,159,915 (GRCm39) G402* probably null Het
Nt5dc1 A T 10: 34,198,673 (GRCm39) V255E probably damaging Het
Or2a20 T A 6: 43,193,928 (GRCm39) F27Y probably damaging Het
Or2y1b A T 11: 49,208,375 (GRCm39) M1L probably null Het
Or52h7 A G 7: 104,214,212 (GRCm39) I261M probably benign Het
Or52z14 G A 7: 103,253,401 (GRCm39) R180H probably benign Het
Otud7a T C 7: 63,407,171 (GRCm39) I50T probably damaging Het
P2ry13 G A 3: 59,116,983 (GRCm39) T265I probably benign Het
Pde4d A G 13: 108,996,733 (GRCm39) S12G probably benign Het
Pigk C A 3: 152,450,154 (GRCm39) N219K probably damaging Het
Plcg1 T A 2: 160,595,509 (GRCm39) probably null Het
Psd2 A T 18: 36,111,717 (GRCm39) D114V probably damaging Het
Ptch1 A T 13: 63,672,884 (GRCm39) I770N probably benign Het
Ptprq A T 10: 107,524,290 (GRCm39) M481K probably benign Het
Rnf216 A C 5: 143,078,814 (GRCm39) M45R probably damaging Het
Rpsa T A 9: 119,960,129 (GRCm39) W231R probably benign Het
Ryr1 G T 7: 28,768,998 (GRCm39) T2797N probably damaging Het
Ryr3 A T 2: 112,666,602 (GRCm39) M1468K probably damaging Het
Slc6a7 A G 18: 61,137,589 (GRCm39) Y244H probably damaging Het
Slco6c1 T A 1: 97,009,049 (GRCm39) D462V probably damaging Het
Spata31d1b A T 13: 59,864,917 (GRCm39) E688D possibly damaging Het
Srpra G A 9: 35,126,766 (GRCm39) R508H probably benign Het
Tnrc18 A T 5: 142,773,737 (GRCm39) I181N unknown Het
Tnrc6a T C 7: 122,791,836 (GRCm39) F1785L probably damaging Het
Trio A T 15: 27,752,811 (GRCm39) D2174E probably benign Het
Ttn C T 2: 76,623,600 (GRCm39) V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 (GRCm39) probably benign Het
Vmn2r113 C T 17: 23,177,321 (GRCm39) P702S probably damaging Het
Vmn2r66 A T 7: 84,656,980 (GRCm39) W142R probably damaging Het
Vmn2r73 A G 7: 85,519,582 (GRCm39) Y459H probably damaging Het
Wsb2 C T 5: 117,515,550 (GRCm39) T385M probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCTGGACACAGCTCATC -3'
(R):5'- TTTGATGCCAAAGATGTGACAAGG -3'

Sequencing Primer
(F):5'- GGGTGCACATAGAAACTCTGTCTC -3'
(R):5'- TGTGACAAGGTAAATAGCTGCATC -3'
Posted On 2016-04-27