Mutagenetix > Incidental Mutations

Incidental Mutation 'R0320:Dym'

38318

Institutional Source

Beutler Lab

Gene Symbol

Dym

Ensembl Gene

ENSMUSG00000035765

Gene Name

dymeclin

Synonyms

C030019K18Rik, 4933427L07Rik, 1810041M12Rik

MMRRC Submission

038530-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0320 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

75018772-75286966 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75199262 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 520 (D520E)

Ref Sequence

ENSEMBL: ENSMUSP00000047054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039608]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039608
AA Change: D520E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047054
Gene: ENSMUSG00000035765
AA Change: D520E

Domain	Start	End	E-Value	Type
Pfam:Dymeclin	1	646	3.3e-174	PFAM
Pfam:Hid1	309	584	3e-11	PFAM

Meta Mutation Damage Score

0.3790

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is necessary for normal skeletal development and brain function. Mutations in this gene are associated with two types of recessive osteochondrodysplasia, Dyggve-Melchior-Clausen (DMC) dysplasia and Smith-McCort (SMC) dysplasia, which involve both skeletal defects and mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele display decreased body size with short tubular bones, chondrodysplasia, partial penetrance of obstructive hydronephrosis and impaired vesicular transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,662,614	T465A	probably benign	Het
9430007A20Rik	A	T	4: 144,522,420	H119L	probably damaging	Het
A430110L20Rik	T	G	1: 181,227,422		noncoding transcript	Het
Abcb10	C	T	8: 123,963,007	R439Q	probably benign	Het
Abcb8	T	C	5: 24,400,790	S199P	probably damaging	Het
Adam8	C	A	7: 139,986,442	C556F	probably damaging	Het
Akap11	T	C	14: 78,513,379	T523A	probably benign	Het
Aldh3b1	T	C	19: 3,918,999		probably benign	Het
Arhgap30	T	A	1: 171,403,804	W230R	possibly damaging	Het
Atp8b4	A	G	2: 126,459,694	I82T	possibly damaging	Het
Bptf	A	T	11: 107,072,819	L1850I	probably damaging	Het
C4b	C	A	17: 34,733,161	V1237L	probably benign	Het
Calu	C	A	6: 29,374,551		probably benign	Het
Ccdc129	T	C	6: 55,976,447	I916T	probably damaging	Het
Cit	C	A	5: 115,979,445	L1227M	possibly damaging	Het
Col4a1	C	T	8: 11,242,782		probably null	Het
Cp	T	C	3: 19,974,848		probably benign	Het
Cpd	T	C	11: 76,840,447	D311G	possibly damaging	Het
Ctc1	T	A	11: 69,033,537	S972T	probably damaging	Het
Dnah17	A	G	11: 118,052,674	F3201L	possibly damaging	Het
Dopey2	C	A	16: 93,810,147	R2113S	probably benign	Het
Eif5a	G	T	11: 69,917,479	T64K	probably benign	Het
Flt3	A	T	5: 147,369,579		probably benign	Het
Ints6	A	T	14: 62,707,635	Y415*	probably null	Het
Itga1	A	G	13: 114,977,594		probably benign	Het
Itgae	A	G	11: 73,130,999	H902R	possibly damaging	Het
Kdm5a	T	C	6: 120,389,620	I406T	probably benign	Het
Lmx1a	C	T	1: 167,791,404	Q111*	probably null	Het
Lrrc25	T	C	8: 70,618,246	Y226H	probably benign	Het
Mcam	T	A	9: 44,140,186	N447K	possibly damaging	Het
Mcm10	A	T	2: 5,004,086	D357E	probably benign	Het
Nrip1	T	C	16: 76,292,363	T769A	probably benign	Het
Ofcc1	G	C	13: 40,206,696	Q286E	probably benign	Het
Olfr382	T	G	11: 73,516,924	I92L	probably damaging	Het
Olfr689	A	T	7: 105,314,654	I217F	probably benign	Het
Parp3	T	A	9: 106,475,812	N55I	possibly damaging	Het
Parp4	T	C	14: 56,588,496		probably null	Het
Pilrb1	G	A	5: 137,854,998	T181I	probably benign	Het
Ppm1n	A	G	7: 19,278,356	V317A	probably damaging	Het
Prdm2	A	T	4: 143,179,351	F55L	probably damaging	Het
Psd2	C	T	18: 35,979,644	R131C	probably damaging	Het
Ralgps1	A	T	2: 33,141,015	C570S	possibly damaging	Het
Scaf8	T	C	17: 3,178,255	S443P	unknown	Het
Setd5	A	G	6: 113,111,481	K190R	probably damaging	Het
Spsb4	T	A	9: 96,996,108	H54L	probably damaging	Het
St7l	T	A	3: 104,870,913	L122*	probably null	Het
Stom	C	T	2: 35,321,634	R125H	probably damaging	Het
Tigd4	T	A	3: 84,595,174	V466E	probably benign	Het
Tmc3	A	C	7: 83,607,819		probably benign	Het
Vcl	C	T	14: 20,985,624		probably benign	Het
Vmn1r168	G	A	7: 23,541,342	R208H	probably benign	Het
Vmn2r75	C	A	7: 86,165,080	V402L	probably benign	Het
Vps13b	A	T	15: 35,674,828	H1698L	probably damaging	Het
Wnt16	T	G	6: 22,297,993	V286G	possibly damaging	Het
Xirp1	C	A	9: 120,016,467	V1117L	probably benign	Het
Zfp788	C	T	7: 41,649,547	H536Y	probably damaging	Het

Other mutations in Dym

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Dym	APN	18	75119249	missense	probably benign	0.43
IGL01593:Dym	APN	18	75114781	splice site	probably benign
IGL02657:Dym	APN	18	75082456	nonsense	probably null
IGL02716:Dym	APN	18	75286683	missense	probably damaging	1.00
IGL02977:Dym	APN	18	75063175	critical splice donor site	probably null
asesino	UTSW	18	75056641	missense	probably damaging	1.00
flavor	UTSW	18	75056738	nonsense	probably null
sabor	UTSW	18	75125539	critical splice donor site	probably null
R0042:Dym	UTSW	18	75125539	critical splice donor site	probably null
R0058:Dym	UTSW	18	75043172	missense	possibly damaging	0.94
R0058:Dym	UTSW	18	75043172	missense	possibly damaging	0.94
R0943:Dym	UTSW	18	75286769	makesense	probably null
R1677:Dym	UTSW	18	75125512	missense	probably damaging	1.00
R2022:Dym	UTSW	18	75080250	missense	probably benign	0.05
R2221:Dym	UTSW	18	75230165	missense	probably damaging	1.00
R2292:Dym	UTSW	18	75199212	missense	possibly damaging	0.95
R4087:Dym	UTSW	18	75230101	missense	probably damaging	1.00
R4929:Dym	UTSW	18	75243286	missense	probably damaging	1.00
R5033:Dym	UTSW	18	75119161	missense	possibly damaging	0.78
R6489:Dym	UTSW	18	75080226	missense	probably benign	0.27
R6641:Dym	UTSW	18	75056641	missense	probably damaging	1.00
R6751:Dym	UTSW	18	75286647	missense	probably damaging	0.98
R6864:Dym	UTSW	18	75056738	nonsense	probably null
R7284:Dym	UTSW	18	75119171	missense	possibly damaging	0.60
R7319:Dym	UTSW	18	75063174	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CGGTTGCTTTTGCAACAGCCTC -3'
(R):5'- ACACAGCCTTGGACGGCTTTTC -3'

Sequencing Primer
(F):5'- CCTGACATTGCTGTCACAGAG -3'
(R):5'- TTGGTTCAACTACTAGGATTCCTGAC -3'

Posted On

2013-05-23