Incidental Mutation 'R0320:Aldh3b1'
ID38319
Institutional Source Beutler Lab
Gene Symbol Aldh3b1
Ensembl Gene ENSMUSG00000024885
Gene Namealdehyde dehydrogenase 3 family, member B1
Synonyms1700001N19Rik, ALDH7, ALDH4
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0320 (G1)
Quality Score193
Status Validated
Chromosome19
Chromosomal Location3913493-3929761 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 3918999 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051803]
Predicted Effect probably benign
Transcript: ENSMUST00000051803
SMART Domains Protein: ENSMUSP00000056276
Gene: ENSMUSG00000024885

DomainStartEndE-ValueType
Pfam:Aldedh 2 428 7.4e-88 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase protein family. Aldehyde dehydrogenases are a family of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The encoded protein is able to oxidize long-chain fatty aldehydes in vitro, and may play a role in protection from oxidative stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,614 T465A probably benign Het
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Cit C A 5: 115,979,445 L1227M possibly damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dopey2 C A 16: 93,810,147 R2113S probably benign Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Nrip1 T C 16: 76,292,363 T769A probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Olfr689 A T 7: 105,314,654 I217F probably benign Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Parp4 T C 14: 56,588,496 probably null Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tigd4 T A 3: 84,595,174 V466E probably benign Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in Aldh3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Aldh3b1 APN 19 3918104 missense probably benign 0.03
IGL01402:Aldh3b1 APN 19 3921205 missense probably benign 0.01
IGL01404:Aldh3b1 APN 19 3921205 missense probably benign 0.01
IGL01784:Aldh3b1 APN 19 3921217 missense probably benign 0.32
IGL02608:Aldh3b1 APN 19 3914061 missense probably damaging 1.00
IGL03223:Aldh3b1 APN 19 3915329 missense probably damaging 0.98
R0472:Aldh3b1 UTSW 19 3914024 missense probably damaging 1.00
R0609:Aldh3b1 UTSW 19 3914024 missense probably damaging 1.00
R1272:Aldh3b1 UTSW 19 3921746 missense probably damaging 1.00
R1721:Aldh3b1 UTSW 19 3921271 splice site probably benign
R1769:Aldh3b1 UTSW 19 3918740 missense probably damaging 1.00
R1868:Aldh3b1 UTSW 19 3921271 splice site probably benign
R1911:Aldh3b1 UTSW 19 3921187 missense probably damaging 0.99
R1912:Aldh3b1 UTSW 19 3921187 missense probably damaging 0.99
R2067:Aldh3b1 UTSW 19 3921755 missense probably benign 0.01
R2913:Aldh3b1 UTSW 19 3921275 splice site probably benign
R4133:Aldh3b1 UTSW 19 3920808 missense probably damaging 1.00
R5129:Aldh3b1 UTSW 19 3915336 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAAAGTAGCGGAACCAGGCCAC -3'
(R):5'- TTCCTGACCATCAGTCAGCGAAAC -3'

Sequencing Primer
(F):5'- TCCACATAGCAGGGGTTCTT -3'
(R):5'- AAACTGGCTCTGGCCTTAG -3'
Posted On2013-05-23