Incidental Mutation 'R4942:Arap1'
ID383195
Institutional Source Beutler Lab
Gene Symbol Arap1
Ensembl Gene ENSMUSG00000032812
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
SynonymsCentd2, 2410002L19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4942 (G1)
Quality Score124
Status Not validated
Chromosome7
Chromosomal Location101348067-101412586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101401802 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 542 (D542G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000098243] [ENSMUST00000107010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084895
AA Change: D927G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812
AA Change: D927G

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
PH 82 175 2.62e-17 SMART
PH 195 285 3.6e-6 SMART
ArfGap 289 415 2.4e-22 SMART
PH 498 606 1.23e-13 SMART
PH 616 710 1.08e0 SMART
RhoGAP 722 904 1.35e-63 SMART
Pfam:RA 926 1015 1.5e-10 PFAM
PH 1029 1141 8.58e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084896
AA Change: D1175G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: D1175G

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 6.6e-13 PFAM
PH 1277 1400 8e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098243
AA Change: D461G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095844
Gene: ENSMUSG00000032812
AA Change: D461G

DomainStartEndE-ValueType
PH 32 140 1.23e-13 SMART
PH 150 244 1.08e0 SMART
RhoGAP 256 438 1.35e-63 SMART
Pfam:RA 460 549 1.2e-11 PFAM
PH 563 675 8.58e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107010
AA Change: D1175G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: D1175G

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 1.9e-10 PFAM
PH 1277 1389 8.58e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153340
Predicted Effect possibly damaging
Transcript: ENSMUST00000154239
AA Change: D542G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210162
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,903,258 R420G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
Adamts7 T C 9: 90,163,311 S23P probably benign Het
Adamtsl1 T A 4: 86,341,214 C824* probably null Het
Adgre1 A G 17: 57,406,903 Y196C probably damaging Het
B3gat1 A G 9: 26,755,598 D42G probably benign Het
Birc6 G A 17: 74,623,050 A2412T probably damaging Het
Bsn A G 9: 108,106,479 Y3459H unknown Het
Cacnb1 T C 11: 98,002,983 Y571C probably damaging Het
Cdk2ap2 G A 19: 4,097,508 probably null Het
Cep57 A G 9: 13,813,427 S265P probably damaging Het
Clca1 A G 3: 145,004,763 I893T probably benign Het
Clca3a2 T A 3: 144,806,502 E491V probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cobl A T 11: 12,254,185 I832N probably damaging Het
Col9a2 T C 4: 121,053,119 V487A possibly damaging Het
Cse1l C T 2: 166,929,794 T325I probably damaging Het
Dlx6 A G 6: 6,863,468 Q30R probably benign Het
Dnah8 T C 17: 30,729,142 V1902A probably benign Het
Dusp8 A G 7: 142,082,228 F542L possibly damaging Het
Emid1 T G 11: 5,129,430 M323L probably benign Het
Ercc5 A G 1: 44,175,965 D886G probably benign Het
Fam184b T C 5: 45,573,307 E461G probably damaging Het
Fbn1 C A 2: 125,383,616 C572F possibly damaging Het
Gigyf1 G T 5: 137,525,690 V1041L possibly damaging Het
Grin3b A G 10: 79,975,722 H714R probably damaging Het
Heatr1 A G 13: 12,413,510 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lypd6b C A 2: 49,946,120 H104Q probably benign Het
Man1a A T 10: 53,933,490 probably null Het
Megf6 A T 4: 154,253,820 D449V probably damaging Het
Mtor T C 4: 148,472,142 V1003A probably benign Het
Ncan C A 8: 70,100,294 W1096L probably damaging Het
Ndor1 C T 2: 25,248,121 probably null Het
Ndufaf1 T C 2: 119,660,066 E171G possibly damaging Het
Nell1 T C 7: 50,120,649 V152A possibly damaging Het
Nt5dc1 A T 10: 34,322,677 V255E probably damaging Het
Olfr10 A T 11: 49,317,548 M1L probably null Het
Olfr434 T A 6: 43,216,994 F27Y probably damaging Het
Olfr619 G A 7: 103,604,194 R180H probably benign Het
Olfr652 A G 7: 104,565,005 I261M probably benign Het
Otud7a T C 7: 63,757,423 I50T probably damaging Het
P2ry13 G A 3: 59,209,562 T265I probably benign Het
Pde4d A G 13: 108,860,199 S12G probably benign Het
Pdzd3 C A 9: 44,248,618 G402* probably null Het
Pigk C A 3: 152,744,517 N219K probably damaging Het
Plcg1 T A 2: 160,753,589 probably null Het
Psd2 A T 18: 35,978,664 D114V probably damaging Het
Ptch1 A T 13: 63,525,070 I770N probably benign Het
Ptprq A T 10: 107,688,429 M481K probably benign Het
Rnf216 A C 5: 143,093,059 M45R probably damaging Het
Rpsa T A 9: 120,131,063 W231R probably benign Het
Ryr1 G T 7: 29,069,573 T2797N probably damaging Het
Ryr3 A T 2: 112,836,257 M1468K probably damaging Het
Slc6a7 A G 18: 61,004,517 Y244H probably damaging Het
Slco6c1 T A 1: 97,081,324 D462V probably damaging Het
Spata31d1b A T 13: 59,717,103 E688D possibly damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Tnrc18 A T 5: 142,787,982 I181N unknown Het
Tnrc6a T C 7: 123,192,613 F1785L probably damaging Het
Trio A T 15: 27,752,725 D2174E probably benign Het
Ttn C T 2: 76,793,256 V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 probably benign Het
Vmn2r113 C T 17: 22,958,347 P702S probably damaging Het
Vmn2r66 A T 7: 85,007,772 W142R probably damaging Het
Vmn2r73 A G 7: 85,870,374 Y459H probably damaging Het
Wsb2 C T 5: 117,377,485 T385M probably damaging Het
Other mutations in Arap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Arap1 APN 7 101388049 missense probably damaging 0.96
IGL01311:Arap1 APN 7 101388136 nonsense probably null
IGL01349:Arap1 APN 7 101387152 missense possibly damaging 0.84
IGL01521:Arap1 APN 7 101400605 critical splice donor site probably null
IGL01869:Arap1 APN 7 101400283 missense probably damaging 1.00
IGL02156:Arap1 APN 7 101388730 unclassified probably benign
IGL02320:Arap1 APN 7 101385029 missense probably benign
IGL02478:Arap1 APN 7 101400125 splice site probably null
R0133:Arap1 UTSW 7 101386229 missense probably damaging 0.98
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0412:Arap1 UTSW 7 101390222 missense probably damaging 0.98
R0616:Arap1 UTSW 7 101401650 missense possibly damaging 0.64
R0838:Arap1 UTSW 7 101400412 missense probably damaging 1.00
R0962:Arap1 UTSW 7 101384914 missense possibly damaging 0.56
R1186:Arap1 UTSW 7 101404269 splice site probably benign
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1724:Arap1 UTSW 7 101400526 missense possibly damaging 0.91
R1793:Arap1 UTSW 7 101388622 missense probably benign
R1959:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R1960:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R2020:Arap1 UTSW 7 101401518 missense probably benign 0.00
R2128:Arap1 UTSW 7 101409320 missense probably damaging 1.00
R3737:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R3851:Arap1 UTSW 7 101390165 nonsense probably null
R4034:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R4386:Arap1 UTSW 7 101385571 missense probably benign
R4435:Arap1 UTSW 7 101390254 missense possibly damaging 0.74
R4779:Arap1 UTSW 7 101404367 missense probably damaging 1.00
R4786:Arap1 UTSW 7 101385005 missense possibly damaging 0.94
R4850:Arap1 UTSW 7 101398791 missense probably damaging 1.00
R5253:Arap1 UTSW 7 101388644 missense probably benign 0.00
R5342:Arap1 UTSW 7 101404960 missense probably benign 0.00
R5367:Arap1 UTSW 7 101409130 missense probably damaging 0.99
R5397:Arap1 UTSW 7 101384912 missense possibly damaging 0.95
R5968:Arap1 UTSW 7 101394738 missense probably damaging 1.00
R6052:Arap1 UTSW 7 101404033 missense probably damaging 1.00
R6574:Arap1 UTSW 7 101404001 missense probably damaging 1.00
R6645:Arap1 UTSW 7 101408111 missense possibly damaging 0.57
R7060:Arap1 UTSW 7 101409357 splice site probably null
R7191:Arap1 UTSW 7 101384992 missense probably benign 0.31
R7323:Arap1 UTSW 7 101400211 missense probably damaging 1.00
R7349:Arap1 UTSW 7 101390228 missense possibly damaging 0.95
R7516:Arap1 UTSW 7 101409331 missense probably benign 0.00
R8034:Arap1 UTSW 7 101394773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGGCAGTGACAGCTGAC -3'
(R):5'- GGCCACAATCTCCTGTAATTTG -3'

Sequencing Primer
(F):5'- AGTGACAGCTGACCCTCC -3'
(R):5'- ACAATCTCCTGTAATTTGGCCCC -3'
Posted On2016-04-27